GE143 - Embedded applications:

Interfaces between digital and biological systems

Dr Robert Batzinger
Instructor Emeritus

Payap University
Chiang Mai, Thailand
3-Sep-2022

0.1 Agenda

  • Computer / nerve interface: pacemakers, brain implants
  • Computer / hormonal and other biochemical dispensers
  • DNA editing, Gene therapy

1 Computer / nerve interface:

1.1 General system description

1.2 The heart

Intro to EKG

1.3 Pacemaker

1.4 Muscle activators

1.5 Brain implants

Cochlea implants

2 Priority guidelines

To be eligible for a cochlear implant, you must have:

  • Hearing loss that interrupts spoken communication
  • Limited benefit from hearing aids as determined by specialized hearing tests
  • Motivation to participate in hearing rehabilitation and be part of the hearing world
  • Realistic expectations of what cochlear implants can and can’t do for hearing

2.1 Cochlear implants improvements

  • Ability to hear speech without needing visual cues such as reading lips
  • Recognition of everyday environmental sounds
  • Ability to listen in a noisy environment
  • Ability to find where sounds are coming from
  • Ability to hear television programs, music and telephone conversations
  • Symptoms of ringing or buzzing (tinnitus) in the implanted ear

3 Prosthetics

4 Artificial arm

5 Hand attachments

5.1 Hand movement

6 Computer / hormonal and other biochemical dispensers

6.1 Biochemical pump

Applications

  • Insulin dispenser
  • Other Hormones:
    • Growth
    • Thyroid
    • Ovulation and Birth control

7 DNA editing, Gene therapy

  • Basic information flow:

$

\[\begin{matrix} DNA & & mRNA & & mRNA \\ \\ -T-A-C-G-T- & \color{yellow}{\longrightarrow} & -U-A-C-G-U- & \color{yellow}{\longrightarrow} &-UAC-GTA\\ | \ \ \ \ \ \ \ | \ \ \ \ \ \ \ | \ \ \ \ \ \ \ | \ \ \ \ \ \ \ | & \color{yellow}{trans-} & & \color{yellow}{trans-} & \\ -A-T-G-C-A- & \color{yellow}{cription} & -A-T-G-C-A- & \color{yellow}{lation} & -Tyr-Val\\ & & & & \\ DNA & & DNA & & Protein \\ \end{matrix}\]

$

7.1 mRNA codons

7.2 Human Insulin DNA sequence

\[\begin{matrix} {}^{AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGT}_{GGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTC}\\ {}^{GTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCT}_{GCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGC}\\ {}^{TGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGG}_{AAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGG}\\ {}^{ACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCT}_{CCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAA}\\ {}^{AAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGA}_{GGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCC}\\ {}^{TCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGT}_{AAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGC}\\ {}^{CCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATA}_{GTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCC}\\ {}^{ACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACAC}_{CCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGG}\\ {}^{GCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCC}_{GGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCA}\\ {}^{GCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATC}_{TGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTC}\\ {}^{CTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC}\\ \end{matrix}\]

7.3 Human Insulin aminoacid sequences

7.4 Sickle Cell anemia

Changes in Genetic Material

Changes in Protein behavior

Changes at the cellular level

7.5 How CRISPR Works

7.6

7.7 Establishing an active CRISPR Gene

  • Use a virus to deliver the DNA to host cell
  • The host DNA is altered to contain the CRISPR binding points
  • The intended gene is attached to CRISPR ends
  • The DNA is inserted into at the CRISPR signal points
  • The CRISPR gene is turned on
  • The new DNA gets replicated and transcribed to RNA
  • Ribosomes convert the RNA into polyamino acids and proteins

CRISPR Host vectors:

  • Mammalian systems (Human, mouse, and rat)
  • Bacteria (E. coli, Streptococcus, Streptomyces, and others)
  • Drosophila
  • Plants (monocots and dicots)
  • C. elegans
  • Yeast (S. cerevisiae and S. pombe)
  • Zebrafish
  • Xenopus

insulin CRISPR

7.8 RNA vaccines

7.9 Stem cell

Sources of Stem Cells

7.10 Cloning

1996

8 Cancer and AI

  • Pattern matching to identify conditions and treatment
  • Search data, parameters and expected outcomes

8.1 What is Cancer?

  • uncontrolled duplication and growth of cells.

  • arises when cells start to divide in response to some stimuli and fail to respond to stop signals

  • faulty tumor suppressor gene: include BRCA1, BRCA2, and p53. Monitors speed of cells division, repairs mismatched DNA, determines when a cell dies

  • active oncogenes: HER2, RAS

8.2 What makes cancer so serious?

  • Cancer cells constantly compete with normal cells for nutrients, blood supply and space
  • Cancer cell can break off and start growing in other parts of the body. A single cell is capable to creating another mass.
  • The stress cancer masses stress surrounding tissue causing pain and organ failure
  • Cancerous cells can produce various biochemicals in toxic amounts.

8.3 Methods for control of tumors

  • Removal of the primarly tumor
  • Killing cancerous cells: drugs, radiation, etc
  • Control cell growth of the cancer
  • Train the immune system to recognize the cells as cells to be eliminated
  • Rehabiliation to accommodate for the loss of tissue/function.

8.4 Cancer treatment

AI currently is useful for

  • Identifying the cancer cell type
  • The stage of the disease
  • The optimal course of treatment
  • Elimination of the cancerous cells

PYU GE143 2022/1: Science and IT for the Quality of Life [6]