BIF7104 - Projet - Analyse de données d’expression

Sommaire : Analyse d’expression du génome entier d’échantillons de fois de 92 adultes et 14 fœtus.

Desing expérimental : L’étude comprend 106 échantillons, 14 de fœtus et 92 d’adultes, sans répétitions. Les échantillons de foie des 14 fœtus ont été obtenus à la semaine de gestation 8-12. Les échantillons de foie adultes ont été recueilli auprès de 50 donneurs d’organes mort accidentellement et 42 patients subissant une ablation partielle du foie due aux tumeurs malignes, le plus souvent chez des patients atteints de cancers du côlon métastatique. Les biopsies du foie de ces patients ont été recueillies à partir de tissu «sain» qui n’ont montré aucun changement pathologique visibles par rapport à la tumeur adjacente.

la suite de l’introduction et l’analyse des données est disponible:
http://rpubs.com/jauger/79235

1. Description des données

Extrait de la matrice des données brute

## Inputting the data ...
## 
## Adding nuID to the data ...
## No Quality Control assessment of the object because it is not a "LumiBatch" object.

	GSM1503720	GSM1503721	GSM1503722	GSM1503723	GSM1503724
Ku8QhfS0n_hIOABXuE	0.4222655	-1.954461	-0.2296993	3.067514	-3.8966110
fqPEquJRRlSVSfL.8A	8.2294550	5.386535	2.5563270	7.600649	7.2569830
ckiehnugOno9d7vf1Q	0.4110274	3.231216	2.7552630	3.171007	0.0444438
x57Vw5B5Fbt5JUnQkI	770.7137000	746.793900	721.9576000	672.142500	652.6106000
ritxUH.kuHlYqjozpE	1214.0710000	1237.507000	1142.0940000	1161.944000	1205.4240000
QpE5UiUgmJOJEkPXpc	12.7572300	23.374980	22.8699200	21.240150	13.7283700

On remarque que les données ne sont pas normalisées…

2. Controle qualité

Le controle qualité est important pour s’Assurer que les données qu’on compare sont vraiment comparable entre elles

Standardisation des données

Standardisation des données avec decostand (vegan). Cette méthode centre la moyenne sur zéro et unifie la variance.

Controle qualité des données dèjà normalisées

Extrait de la matrice d’expression des gènes

	Fetal	Fetal	Adult_accident	Adult_accident	Adult_cancer	Adult_cancer
fqPEquJRRlSVSfL.8A	4.248890	4.021668	4.853600	4.623503	4.286804	4.187977
ckiehnugOno9d7vf1Q	3.589026	3.853151	3.996015	4.424531	4.851610	4.779911
x57Vw5B5Fbt5JUnQkI	9.482884	9.337328	9.012896	10.959112	10.552464	10.750783
ritxUH.kuHlYqjozpE	10.167734	10.142569	10.035402	11.588105	11.259778	11.375939
QpE5UiUgmJOJEkPXpc	4.480946	4.816507	4.932566	7.313574	6.909689	6.544238
Bx496XsFXiAlj.Eaeo	5.122735	5.078283	3.765689	5.509650	6.467909	7.124121

Résumé de la matrice

3. Annotation des gènes

Détermination des IDs entrezgene à partir des nuIDs

Nom des gènes: nuID (nucleotide universal identifier). À partir d’une séquence d’acides aminés (dans ce cas la séquence des sondes), on obtient un symbol qui est traduisible en séquence avec la fonction id2seq : Exemple: Ku8QhfS0n_hIOABXuE

## [1] "GTGTTACAAGACCTTCAGTCAGCTTTGGACAGAATGAAAAACCCTGTGAC"

à partir duquel on peut savoir à quel gène (entrezID) (nuID2EntrezID) Exemple: Ku8QhfS0n_hIOABXuE

## The provided names of filterTh does not match the field names of nuID_MappingInfo table!
##  No filtering will be performed!

## Ku8QhfS0n_hIOABXuE 
##           "346389"

Extrait de la matrice d’expression avec entrezgene

	Fetal	Fetal	Fetal	Fetal	Fetal
1	4.248890	4.021668	3.772319	4.357742	4.087132
1	3.589026	3.853151	3.789936	3.963339	3.489125
29974	9.482884	9.337328	9.378861	9.595830	9.161382
29974	10.167734	10.142569	10.085749	10.387303	10.073084
29974	4.480946	4.816507	4.843682	5.141674	4.435351
87769	5.122735	5.078283	4.691750	4.980442	4.832459

Annotation des gènes avec bioMart

BioMart est un ensemble de base de données destinées à l’annotation des gènes et maintenues par bioconductor.

Estrait des données d’annotation

4. Analyse différencielle

Comparison pair-wise (Statistiques de Fisher)

3 groupes: Fetus, Adult-accident et Adult-cancer

Matrice du design

	fetal	accident	cancer
1	1	0	0
2	1	0	0
3	1	0	0
	…	…	…
15	0	1	0
16	0	1	0
17	0	1	0
18	0	1	0
	…	…	…
65	0	0	1
66	0	0	1
67	0	0	1
68	0	0	1

Modèle linéaire

Matrice de contraste

Premières lignes de la topTable annotée Fetus vs Accident

entrezgene	logFC	AveExpr	t	P.Value	adj.P.Val	B	hgnc_symbol	ensembl_transcript_id	description
1	4.9918410	4.847916	54.291472	0.0000000	0.0000000	172.925315	A1BG	ENST00000596924	alpha-1-B glycoprotein [Source:HGNC Symbol;Acc:HGNC:5]
10	0.1454660	5.712242	1.675329	0.0967487	0.1553646	-6.503711	NAT2	ENST00000286479	N-acetyltransferase 2 (arylamine N-acetyltransferase) [Source:HGNC Symbol;Acc:HGNC:7646]
100	2.7062941	4.668284	21.099002	0.0000000	0.0000000	81.040987	ADA	ENST00000464097	adenosine deaminase [Source:HGNC Symbol;Acc:HGNC:186]
1000	-0.8827620	6.229116	-7.009722	0.0000000	0.0000000	12.518572	CDH2	ENST00000269141	cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:HGNC:1759]
10000	2.1740491	5.304701	16.845899	0.0000000	0.0000000	62.281163	AKT3	ENST00000336199	v-akt murine thymoma viral oncogene homolog 3 [Source:HGNC Symbol;Acc:HGNC:393]
10001	0.2052302	5.153271	1.932780	0.0558693	0.0961727	-6.049320	MED6	ENST00000554963	mediator complex subunit 6 [Source:HGNC Symbol;Acc:HGNC:19970]

Premières lignes de la topTable annotée Fetus vs Cancer

entrezgene	logFC	AveExpr	t	P.Value	adj.P.Val	B	hgnc_symbol	ensembl_transcript_id	description
1	5.0716538	4.847916	54.045072	0.0000000	0.0000000	172.401768	A1BG	ENST00000596924	alpha-1-B glycoprotein [Source:HGNC Symbol;Acc:HGNC:5]
10	-0.1798743	4.265716	-1.792586	0.0758251	0.1217619	-6.283593	NAT2	ENST00000286479	N-acetyltransferase 2 (arylamine N-acetyltransferase) [Source:HGNC Symbol;Acc:HGNC:7646]
100	3.8334779	4.301521	20.785653	0.0000000	0.0000000	79.744560	ADA	ENST00000464097	adenosine deaminase [Source:HGNC Symbol;Acc:HGNC:186]
1000	-0.6117572	5.154613	-7.322148	0.0000000	0.0000000	14.068421	CDH2	ENST00000269141	cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:HGNC:1759]
10000	-3.1798082	6.516053	-16.882427	0.0000000	0.0000000	62.464659	AKT3	ENST00000336199	v-akt murine thymoma viral oncogene homolog 3 [Source:HGNC Symbol;Acc:HGNC:393]
10001	-0.2513475	6.903630	-2.053559	0.0424223	0.0730251	-5.794572	MED6	ENST00000554963	mediator complex subunit 6 [Source:HGNC Symbol;Acc:HGNC:19970]

Premières lignes de la topTable annotée Cancer vs Accident

entrezgene	logFC	AveExpr	t	P.Value	adj.P.Val	B	hgnc_symbol	ensembl_transcript_id	description
1	1.8184439	6.864074	18.121214	0.0000000	0.0000000	67.804833	A1BG	ENST00000596924	alpha-1-B glycoprotein [Source:HGNC Symbol;Acc:HGNC:5]
10	-0.1049068	5.478501	-1.293088	0.1987265	0.3191264	-6.099121	NAT2	ENST00000286479	N-acetyltransferase 2 (arylamine N-acetyltransferase) [Source:HGNC Symbol;Acc:HGNC:7646]
100	1.5551068	7.877822	9.050954	0.0000000	0.0000000	23.481651	ADA	ENST00000464097	adenosine deaminase [Source:HGNC Symbol;Acc:HGNC:186]
1000	0.3753385	3.794488	4.369870	0.0000286	0.0001825	1.857020	CDH2	ENST00000269141	cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:HGNC:1759]
10000	-1.1855973	6.991491	-7.958845	0.0000000	0.0000000	17.948722	AKT3	ENST00000336199	v-akt murine thymoma viral oncogene homolog 3 [Source:HGNC Symbol;Acc:HGNC:393]
10001	-0.2109085	3.763177	-1.466952	0.1452810	0.2500659	-5.863443	MED6	ENST00000554963	mediator complex subunit 6 [Source:HGNC Symbol;Acc:HGNC:19970]

Les histogrammes de p-value permet d’illustrer, pour chaque paire de groupes testés, la distribution des p-values. Ici, on peut voir que beaucoup de gènes très significativement modulés (hautes p-values) et une distribution plutôt uniforme pour les autres valeurs.

MAplots (AvgExpr , logFC)

Volcano plots

Venn diagram

5. Sélection des gènes

10 gènes les plus significatifs fetal-accident

	entrezgene	logFC	AveExpr	t	B	hgnc_symbol	ensembl_transcript_id	description
9195	87769	6.079831	4.041707	51.11015	166.78107	GGACT	ENST00000376250	gamma-glutamylamine cyclotransferase [Source:HGNC Symbol;Acc:HGNC:25100]
8677	8086	5.788777	5.513322	42.96708	149.17869	AAAS	ENST00000209873	achalasia, adrenocortical insufficiency, alacrimia [Source:HGNC Symbol;Acc:HGNC:13666]
2930	22848	4.991717	4.551680	38.09995	137.09445	AAK1	ENST00000606389	AP2 associated kinase 1 [Source:HGNC Symbol;Acc:HGNC:19679]
9172	8714	3.171396	4.368388	29.04971	110.47469	ABCC3	ENST00000515707	ATP-binding cassette, sub-family C (CFTR/MRP), member 3 [Source:HGNC Symbol;Acc:HGNC:54]
147	10057	2.800792	4.353750	28.93665	110.10082	ABCC5	ENST00000334444	ATP-binding cassette, sub-family C (CFTR/MRP), member 5 [Source:HGNC Symbol;Acc:HGNC:56]
150	10060	8.621162	5.783661	28.34818	108.13614	ABCC9	ENST00000261200	ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:HGNC:60]
3023	23	3.545276	3.996892	28.07968	107.22906	ABCF1	ENST00000421042	ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:HGNC:70]
1518	130013	4.751028	5.351986	23.43176	90.38699	ACMSD	ENST00000356140	aminocarboxymuconate semialdehyde decarboxylase [Source:HGNC Symbol;Acc:HGNC:19288]
7197	57001	4.829235	5.045363	23.42978	90.37932	ACN9	ENST00000432641	ACN9 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:HGNC:21752]
3526	2515	2.685221	4.895690	20.97645	80.53207	ADAM2	ENST00000620181	ADAM metallopeptidase domain 2 [Source:HGNC Symbol;Acc:HGNC:198]

10 gènes les plus significatifs cancer-accident

	entrezgene	logFC	AveExpr	t	B	hgnc_symbol	ensembl_transcript_id	description
6529	53947	1.9069903	6.971274	13.574875	46.55687	A4GALT	ENST00000401850	alpha 1,4-galactosyltransferase [Source:HGNC Symbol;Acc:HGNC:18149]
3023	23	1.9269182	7.932809	10.689180	31.91840	ABCF1	ENST00000421042	ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:HGNC:70]
9128	86	-0.7143012	9.169498	-9.271966	24.61483	ACTL6A	ENST00000429709	actin-like 6A [Source:HGNC Symbol;Acc:HGNC:24124]
1457	128	0.7416583	4.741236	8.618977	21.27755	ADH5	ENST00000296412	alcohol dehydrogenase 5 (class III), chi polypeptide [Source:HGNC Symbol;Acc:HGNC:253]
1017	113622	1.3411958	6.250165	8.481664	20.58066	ADPRHL1	ENST00000356501	ADP-ribosylhydrolase like 1 [Source:HGNC Symbol;Acc:HGNC:21303]
1293	122622	-0.9225160	7.012997	-8.431463	20.32641	ADSSL1	ENST00000330877	adenylosuccinate synthase like 1 [Source:HGNC Symbol;Acc:HGNC:20093]
496	10555	-1.2335417	4.202796	-8.272638	19.52401	AGPAT2	ENST00000371694	1-acylglycerol-3-phosphate O-acyltransferase 2 [Source:HGNC Symbol;Acc:HGNC:325]
2522	199	0.6793750	9.047294	8.142941	18.87119	AIF1	ENST00000383474	allograft inflammatory factor 1 [Source:HGNC Symbol;Acc:HGNC:352]
2687	210	-1.0594993	6.793789	-7.952000	17.91452	ALAD	ENST00000409155	aminolevulinate dehydratase [Source:HGNC Symbol;Acc:HGNC:395]
1281	121642	1.4675434	8.091083	7.775714	17.03641	ALKBH2	ENST00000343075	alkB, alkylation repair homolog 2 (E. coli) [Source:HGNC Symbol;Acc:HGNC:32487]

10 gènes les plus significatifs fetal-cancer

	entrezgene	logFC	AveExpr	t	B	hgnc_symbol	ensembl_transcript_id	description
4720	29974	6.098110	4.708711	52.27345	169.01512	A1CF	ENST00000374001	APOBEC1 complementation factor [Source:HGNC Symbol;Acc:HGNC:24086]
9195	87769	6.172259	4.041707	50.83881	166.18812	GGACT	ENST00000376250	gamma-glutamylamine cyclotransferase [Source:HGNC Symbol;Acc:HGNC:25100]
5709	404744	6.653217	4.822093	44.43247	152.53428	NPSR1-AS1	ENST00000419766	NPSR1 antisense RNA 1 [Source:HGNC Symbol;Acc:HGNC:22128]
8677	8086	6.143836	4.569347	40.50610	143.20907	AAAS	ENST00000209873	achalasia, adrenocortical insufficiency, alacrimia [Source:HGNC Symbol;Acc:HGNC:13666]
2930	22848	7.645796	4.468302	37.23930	134.79454	AAK1	ENST00000606389	AP2 associated kinase 1 [Source:HGNC Symbol;Acc:HGNC:19679]
9172	8714	4.515019	3.448558	28.48178	108.58259	ABCC3	ENST00000515707	ATP-binding cassette, sub-family C (CFTR/MRP), member 3 [Source:HGNC Symbol;Acc:HGNC:54]
147	10057	4.687815	6.054722	27.99468	106.93890	ABCC5	ENST00000334444	ATP-binding cassette, sub-family C (CFTR/MRP), member 5 [Source:HGNC Symbol;Acc:HGNC:56]
150	10060	2.749911	4.353750	27.83695	106.40187	ABCC9	ENST00000261200	ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:HGNC:60]
3704	25864	2.660306	3.986497	26.26922	100.93341	ABHD14A	ENST00000497864	abhydrolase domain containing 14A [Source:HGNC Symbol;Acc:HGNC:24538]
1518	130013	4.555676	6.292746	22.92540	88.41793	ACMSD	ENST00000356140	aminocarboxymuconate semialdehyde decarboxylase [Source:HGNC Symbol;Acc:HGNC:19288]

5 gènes plus augmentés (fetus-accident)

	entrezgene	logFC	AveExpr	t	B	hgnc_symbol	ensembl_transcript_id	description
150	10060	8.621162	5.783661	28.34818	108.13614	ABCC9	ENST00000261200	ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:HGNC:60]
8677	8086	5.788777	5.513322	42.96708	149.17869	AAAS	ENST00000209873	achalasia, adrenocortical insufficiency, alacrimia [Source:HGNC Symbol;Acc:HGNC:13666]
2930	22848	4.991717	4.551680	38.09995	137.09445	AAK1	ENST00000606389	AP2 associated kinase 1 [Source:HGNC Symbol;Acc:HGNC:19679]
7197	57001	4.829235	5.045363	23.42978	90.37932	ACN9	ENST00000432641	ACN9 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:HGNC:21752]
1518	130013	4.751028	5.351986	23.43176	90.38699	ACMSD	ENST00000356140	aminocarboxymuconate semialdehyde decarboxylase [Source:HGNC Symbol;Acc:HGNC:19288]
3310	23400	4.675468	10.199897	11.78558	37.13690	ATP13A2	ENST00000326735	ATPase type 13A2 [Source:HGNC Symbol;Acc:HGNC:30213]
5582	396	4.636584	10.263277	13.00729	43.44072	ARHGDIA	ENST00000582520	Rho GDP dissociation inhibitor (GDI) alpha [Source:HGNC Symbol;Acc:HGNC:678]
3940	26286	3.860128	4.694028	13.23203	44.58736	ARFGAP3	ENST00000263245	ADP-ribosylation factor GTPase activating protein 3 [Source:HGNC Symbol;Acc:HGNC:661]
5792	417	3.800786	3.742609	12.43207	40.48627	ART1	ENST00000529556	ADP-ribosyltransferase 1 [Source:HGNC Symbol;Acc:HGNC:723]
3023	23	3.545276	3.996892	28.07968	107.22906	ABCF1	ENST00000421042	ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:HGNC:70]

5 gènes plus dimimués (fetus-accident)

	entrezgene	logFC	AveExpr	t	B	hgnc_symbol	ensembl_transcript_id	description
4838	312	-5.078377	9.635645	-14.143339	49.18735	ANXA13	ENST00000262219	annexin A13 [Source:HGNC Symbol;Acc:HGNC:536]
7234	57143	-4.291101	8.338213	-20.293894	77.66409	ADCK1	ENST00000238561	aarF domain containing kinase 1 [Source:HGNC Symbol;Acc:HGNC:19038]
4533	28984	-4.188437	6.616277	-9.639309	25.90839	RGCC	ENST00000379359	regulator of cell cycle [Source:HGNC Symbol;Acc:HGNC:20369]
1448	127687	-3.750984	11.775076	-8.882910	21.97025	C1orf122	ENST00000373043	chromosome 1 open reading frame 122 [Source:HGNC Symbol;Acc:HGNC:24789]
4537	28990	-3.644817	5.803626	-12.061201	38.56817	ASTE1	ENST00000514044	asteroid homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:HGNC:25021]
172	10093	-3.610703	8.764294	-12.532255	41.00275	ARPC4	ENST00000498623	actin related protein 2/3 complex, subunit 4, 20kDa [Source:HGNC Symbol;Acc:HGNC:707]
3336	23452	-3.431124	7.069440	-14.995831	53.41076	ANGPTL2	ENST00000373425	angiopoietin-like 2 [Source:HGNC Symbol;Acc:HGNC:490]
1824	145645	-3.402382	10.624793	-9.400709	24.66232	C15orf43	ENST00000340827	chromosome 15 open reading frame 43 [Source:HGNC Symbol;Acc:HGNC:28520]
1943	149563	-3.296115	8.596678	-8.721819	21.13724	C1orf64	ENST00000329454	chromosome 1 open reading frame 64 [Source:HGNC Symbol;Acc:HGNC:28339]
1223	118663	-3.004229	8.820245	-10.207852	28.88548	BTBD16	ENST00000260723	BTB (POZ) domain containing 16 [Source:HGNC Symbol;Acc:HGNC:26340]

6. Ontologie des gènes

Résumé de l’ontologie des gènes

Fetus - Adult accident

GOBPID	Pvalue	OddsRatio	ExpCount	Count	Size	Term
GO:0051235	2.70e-06	2.187553	28.82705	54	222	maintenance of location
GO:0019058	7.89e-05	1.810950	37.65695	61	290	viral life cycle
GO:0044766	8.99e-05	4.609570	4.15525	13	32	multi-organism transport
GO:0046794	8.99e-05	4.609570	4.15525	13	32	transport of virus
GO:0075733	8.99e-05	4.609570	4.15525	13	32	intracellular transport of virus
GO:1902583	8.99e-05	4.609570	4.15525	13	32	multi-organism intracellular transport

Adult accident - Adult cancer

GOBPID	Pvalue	OddsRatio	ExpCount	Count	Size	Term
GO:0006302	0.0000859	3.334049	5.3465886	16	130	double-strand break repair
GO:0043928	0.0001360	7.493528	1.1927005	7	29	exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay
GO:0000291	0.0002133	6.868091	1.2749557	7	31	nuclear-transcribed mRNA catabolic process, exonucleolytic
GO:2000725	0.0002465	11.746244	0.6169141	5	15	regulation of cardiac muscle cell differentiation
GO:0045978	0.0002684	70.287854	0.1645104	3	4	negative regulation of nucleoside metabolic process
GO:0000724	0.0003840	4.142300	2.7555495	10	67	double-strand break repair via homologous recombination

Recherche des pathways avec KEGG

alt text

BIF7104 - Projet - Analyse de données d’expression

Simon Pelletier, Jérémie Auger & Xavier Lecours Boucher

2015-05-06

1. Description des données

2. Controle qualité

Standardisation des données

Controle qualité des données dèjà normalisées

3. Annotation des gènes

Détermination des IDs entrezgene à partir des nuIDs

Annotation des gènes avec bioMart

4. Analyse différencielle

Comparison pair-wise (Statistiques de Fisher)

Modèle linéaire

5. Sélection des gènes

6. Ontologie des gènes

Résumé de l’ontologie des gènes

Recherche des pathways avec KEGG

	fetal	accident	cancer
1	1	0	0
2	1	0	0
3	1	0	0
	…	…	…
15	0	1	0
16	0	1	0
17	0	1	0
18	0	1	0
	…	…	…
65	0	0	1
66	0	0	1
67	0	0	1
68	0	0	1

	fetal	accident	cancer
1	1	0	0
2	1	0	0
3	1	0	0
	…	…	…
15	0	1	0
16	0	1	0
17	0	1	0
18	0	1	0
	…	…	…
65	0	0	1
66	0	0	1
67	0	0	1
68	0	0	1

	fetal	accident	cancer
1	1	0	0
2	1	0	0
3	1	0	0
	…	…	…
15	0	1	0
16	0	1	0
17	0	1	0
18	0	1	0
	…	…	…
65	0	0	1
66	0	0	1
67	0	0	1
68	0	0	1