Since we’ve got trimmed input fastq files and a prepped genome, it’s time to start the alignment. This is the slow step, but the files aren’t super huge/there arenlt a ton, so hopefully this will only take a few days.
setwd("~/Documents/C-virginica-BSSeq/")
bismark.genome <- "~/Documents/C-virginica-BSSeq/genome"
trimmed.input.files <- list.files(pattern = "trimmed*")[1:6]
for(i in 1:length(trimmed.input.files)) {
system(paste0("/home/shared/Bismark/bismark --multicore 9 -N 1 -q --genome ", bismark.genome, " --se ", trimmed.input.files[i], " -o ~/Documents/C-virginica-BSSeq/", substr(trimmed.input.files[i], 1, 17)))
}Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_ACAGTG_L001_R1.fastq
Files to be analysed:
trimmed-2112_lane1_ACAGTG_L001_R1.fastqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 2240 and offset 9
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ACAGTG_L001_R1.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_ACAGTG_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8 to trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2 (1362272 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7 (1362271 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5 (1362272 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1 (1362272 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9 (1362271 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3 (1362272 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8 (1362271 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6 (1362271 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4 (1362272 sequences in total)
Input file is trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1475:2133_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGGTTAGGTTGATTTTAAATTTGAGGAAGTTTGTGTAGGAAGAGTTTATGAATATTTAAATTTTTTGTTATAGTTATAAGAAAATAGATTGGAAGAGTATA B@?DFFFFCFHHGJJJJJJJJJJJJIIJJHIIJJIIIIIJJIGHGIJGIIJFIIJIJFHEHHGFFDDCEEDEEAA>ACCDDCDDDDDDDCDDBDDDDDCB? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1771:2189_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGATGGTGTGTGATAGATTGATTAATATGTAATTTAAAAAATATGATAGTATTTATTTTGTTAAAATATAAGGTTGGTTTTAGTAGGGTTTTTAAAGATTG BC;DDFFFHHFHHIIGFGIJGIGIIIJJIIIJGIJJJJJJJGIHHGHHFEFFEFDEFEEEEEEEEDBBDBDBD:C9@<ADDDDDDDDD38?BCCCDCDCDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1754:2166_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTGGTGTTTTTTATAATAGATGTAATGTGAGTAGTAGATTTTTTTTGTTGATAAGTAAGTATTTTATTTTGTGTATATATTTGGTTTTTTGTATTTTGGTG @@@DDDA1CFHHFIJGGGJJJFGGIJJJJDHBHJGHGIJJI;CECHI=EHIGHHEEEDFFDDEEEEDECD3;?;A>ACEECDCDCCCCDDDBCDCDEDCC@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1732:2172_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTAAAAAATTATATTAATTTTTGTTGTTTATTAATTTTAATTAATTAATTAATAAATTTATTTTATAATTAATTGATTATTAATTATTATTGTTTAT ?@@ADFFFGBHGHIIIIIIIGGEGHIFIIIIGHIIIIIIIIIICHHIIIIACEHHFHHHEFFFFCCEEEDEDDDD@A?B8=BBDDDCDDDDCDECD@BDBC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2063:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 AGTGGGGTGATGTTTTTATTGGTGTGG @@?DFFFDHHHHDHIJJJJJJIIII?F YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1596:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TGGTTATTGTTATTGTTTAGATTGTATTTGTGTTTTATGTGAATAGTTTAGTTTTGGAGGATGTAATTGATTGGTGAAGTGTGTTGTTTATTGGGATAAGA =;14ADD?BFDHHGHIIIIIEIGGEHDFHHGECGFHEHEEDBGG@B?FGIIBHHGIIIIIEHE9BEC@=@B?BB555@C>ADCCCBBBBBECBBB@BBB@9 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2162:2117_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTTTTTTTTATTATTGTTATTGTTATTGTAAAAAATTATTAATTTTGATTTATTATTGTTTGTTGTTATGATATGATTTAAAAAGATTGGAAGAGTA @@CFBDDDFHHFHIG:EGHGIGGFFHGIIIIIBFDDDDF;@FCHIGEHEHDFFCAEECAC;:=??@BB055;@9>09@B-59@C>>CC@B@CBBBB@BB?> YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2042:2170_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GAATAAGTTAATATTTGGTGAATTTTGTTTTATAATGATAGGAAGAGTTGATATTGAAGGATTAGAAAGTAATGTTGTTATAAATGTTTGATTGTTATAAG @@1BDDDDHHFHHJGFHIFGGIIJJIIIIIJJJCFGGGGIIFBFHIIIJJGGIJJIEGHHIHGHHHDFEFFEEDA=@DDBDEDED?BDDDDDDDDDDDDD? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1243:2121_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTATTAAATATTATGATTTTATTTGATAATAAATTTTAATTATATGTTATATTTATATTTTTTTTTTTTAATATATTTTGTTTATTAAATTATTTTATTA CCCFFFFFHHHHHJJJAFHGIJJJJJGGIIGGIJJJIJJIJJIJIIJIIIJGHGHFHIJIJJJHFHHHHFFFFFFFEEEEDACDDDDECCCDDDDDDDDD: YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1754:2166_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTGGTGTTTTTTATAATAGATGTAATGTGAGTAGTAGATTTTTTTTGTTGATAAGTAAGTATTTTATTTTGTGTATATATTTGGTTTTTTGTATTTTGGTG @@@DDDA1CFHHFIJGGGJJJFGGIJJJJDHBHJGHGIJJI;CECHI=EHIGHHEEEDFFDDEEEEDECD3;?;A>ACEECDCDCCCCDDDBCDCDEDCC@ YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1596:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TGGTTATTGTTATTGTTTAGATTGTATTTGTGTTTTATGTGAATAGTTTAGTTTTGGAGGATGTAATTGATTGGTGAAGTGTGTTGTTTATTGGGATAAGA =;14ADD?BFDHHGHIIIIIEIGGEHDFHHGECGFHEHEEDBGG@B?FGIIBHHGIIIIIEHE9BEC@=@B?BB555@C>ADCCCBBBBBECBBB@BBB@9 YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1475:2133_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGGTTAGGTTGATTTTAAATTTGAGGAAGTTTGTGTAGGAAGAGTTTATGAATATTTAAATTTTTTGTTATAGTTATAAGAAAATAGATTGGAAGAGTATA B@?DFFFFCFHHGJJJJJJJJJJJJIIJJHIIJJIIIIIJJIGHGIJGIIJFIIJIJFHEHHGFFDDCEEDEEAA>ACCDDCDDDDDDDCDDBDDDDDCB? YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2162:2117_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTTTTTTTTATTATTGTTATTGTTATTGTAAAAAATTATTAATTTTGATTTATTATTGTTTGTTGTTATGATATGATTTAAAAAGATTGGAAGAGTA @@CFBDDDFHHFHIG:EGHGIGGFFHGIIIIIBFDDDDF;@FCHIGEHEHDFFCAEECAC;:=??@BB055;@9>09@B-59@C>>CC@B@CBBBB@BB?> YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2042:2170_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GAATAAGTTAATATTTGGTGAATTTTGTTTTATAATGATAGGAAGAGTTGATATTGAAGGATTAGAAAGTAATGTTGTTATAAATGTTTGATTGTTATAAG @@1BDDDDHHFHHJGFHIFGGIIJJIIIIIJJJCFGGGGIIFBFHIIIJJGGIJJIEGHHIHGHHHDFEFFEEDA=@DDBDEDED?BDDDDDDDDDDDDD? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1771:2189_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGATGGTGTGTGATAGATTGATTAATATGTAATTTAAAAAATATGATAGTATTTATTTTGTTAAAATATAAGGTTGGTTTTAGTAGGGTTTTTAAAGATTG BC;DDFFFHHFHHIIGFGIJGIGIIIJJIIIJGIJJJJJJJGIHHGHHFEFFEFDEFEEEEEEEEDBBDBDBD:C9@<ADDDDDDDDD38?BCCCDCDCDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1732:2172_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTAAAAAATTATATTAATTTTTGTTGTTTATTAATTTTAATTAATTAATTAATAAATTTATTTTATAATTAATTGATTATTAATTATTATTGTTTAT ?@@ADFFFGBHGHIIIIIIIGGEGHIFIIIIGHIIIIIIIIIICHHIIIIACEHHFHHHEFFFFCCEEEDEDDDD@A?B8=BBDDDCDDDDCDECD@BDBC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2063:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 AGTGGGGTGATGTTTTTATTGGTGTGG @@?DFFFDHHHHDHIJJJJJJIIII?F YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1243:2121_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTATTAAATATTATGATTTTATTTGATAATAAATTTTAATTATATGTTATATTTATATTTTTTTTTTTTAATATATTTTGTTTATTAAATTATTTTATTA CCCFFFFFHHHHHJJJAFHGIJJJJJGGIIGGIJJJIJJIJJIJIIJIIIJGHGHFHIJIJJJHFHHHHFFFFFFFEEEEDACDDDDECCCDDDDDDDDD: YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8
Reading in the sequence file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:21061:20356_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:21061:20356_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:21061:20356_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:21061:20356_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:5351:22388_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:5351:22388_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:5351:22388_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:5351:22388_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20966:40323_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20966:40323_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20966:40323_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20966:40323_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:16226:93261_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:16226:93261_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:16226:93261_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:16226:93261_1:N:0:ACAGTG' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:12503:93950_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:12503:93950_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:12503:93950_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:12503:93950_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2305:2094:74315_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2305:2094:74315_1:N:0:ACAGTG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2305:2094:74315_1:N:0:ACAGTG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2305:2094:74315_1:N:0:ACAGTG' because it was < 2 characters long
1362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1234763 (90.64%) aligned 0 times
53551 (3.93%) aligned exactly 1 time
73957 (5.43%) aligned >1 times
9.36% overall alignment rate
1362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1232706 (90.49%) aligned 0 times
54461 (4.00%) aligned exactly 1 time
75104 (5.51%) aligned >1 times
9.51% overall alignment rateProcessed 1362271 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362271
Number of alignments with a unique best hit from the different alignments: 91319
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1893643
Total methylated C's in CpG context: 315976
Total methylated C's in CHG context: 282608
Total methylated C's in CHH context: 898448
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35951
Total unmethylated C's in CHG context: 143972
Total unmethylated C's in CHH context: 216688
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.8%
C methylated in CHG context: 66.2%
C methylated in CHH context: 80.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1181948
Sequences did not map uniquely: 89004
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46886 ((converted) top strand)
CT/GA: 44433 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1232577 (90.48%) aligned 0 times
54236 (3.98%) aligned exactly 1 time
75458 (5.54%) aligned >1 times
9.52% overall alignment rate
1362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1235169 (90.67%) aligned 0 times
53354 (3.92%) aligned exactly 1 time
73748 (5.41%) aligned >1 times
9.33% overall alignment rateProcessed 1362271 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362271
Number of alignments with a unique best hit from the different alignments: 90941
Mapping efficiency: 6.7%Sequences with no alignments under any condition: 1182276
Sequences did not map uniquely: 89054
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46698 ((converted) top strand)
CT/GA: 44243 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1892356
Total methylated C's in CpG context: 313889
Total methylated C's in CHG context: 282349
Total methylated C's in CHH context: 899333
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35452
Total unmethylated C's in CHG context: 143652
Total unmethylated C's in CHH context: 217681
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 66.3%
C methylated in CHH context: 80.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1232358 (90.46%) aligned 0 times
54448 (4.00%) aligned exactly 1 time
75466 (5.54%) aligned >1 times
9.54% overall alignment rate
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1234861 (90.65%) aligned 0 times
53427 (3.92%) aligned exactly 1 time
73984 (5.43%) aligned >1 times
9.35% overall alignment rateProcessed 1362272 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362272
Number of alignments with a unique best hit from the different alignments: 91148
Mapping efficiency: 6.7%Sequences with no alignments under any condition: 1181894
Sequences did not map uniquely: 89230
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46937 ((converted) top strand)
CT/GA: 44211 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1896920
Total methylated C's in CpG context: 313460
Total methylated C's in CHG context: 281701
Total methylated C's in CHH context: 901142
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35915
Total unmethylated C's in CHG context: 145719
Total unmethylated C's in CHH context: 218983
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.7%
C methylated in CHG context: 65.9%
C methylated in CHH context: 80.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1232355 (90.46%) aligned 0 times
54585 (4.01%) aligned exactly 1 time
75332 (5.53%) aligned >1 times
9.54% overall alignment rate
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1235516 (90.70%) aligned 0 times
53245 (3.91%) aligned exactly 1 time
73511 (5.40%) aligned >1 times
9.30% overall alignment rateProcessed 1362272 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362272
Number of alignments with a unique best hit from the different alignments: 90802
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1887719
Total methylated C's in CpG context: 313218
Total methylated C's in CHG context: 279797
Total methylated C's in CHH context: 896999
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35314
Total unmethylated C's in CHG context: 144609
Total unmethylated C's in CHH context: 217782
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 65.9%
C methylated in CHH context: 80.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1182658
Sequences did not map uniquely: 88812
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46938 ((converted) top strand)
CT/GA: 43864 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1234909 (90.65%) aligned 0 times
53929 (3.96%) aligned exactly 1 time
73434 (5.39%) aligned >1 times
9.35% overall alignment rate
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1232787 (90.49%) aligned 0 times
54559 (4.01%) aligned exactly 1 time
74926 (5.50%) aligned >1 times
9.51% overall alignment rateProcessed 1362272 sequences in total1362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1235478 (90.69%) aligned 0 times
53302 (3.91%) aligned exactly 1 time
73491 (5.39%) aligned >1 times
9.31% overall alignment rate
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362272
Number of alignments with a unique best hit from the different alignments: 91556
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1904041
Total methylated C's in CpG context: 316667
Total methylated C's in CHG context: 282461
Total methylated C's in CHH context: 900556
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 36164
Total unmethylated C's in CHG context: 146513
Total unmethylated C's in CHH context: 221680
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.8%
C methylated in CHG context: 65.8%
C methylated in CHH context: 80.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1182016
Sequences did not map uniquely: 88700
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46960 ((converted) top strand)
CT/GA: 44596 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1232680 (90.49%) aligned 0 times
54543 (4.00%) aligned exactly 1 time
75048 (5.51%) aligned >1 times
9.51% overall alignment rateProcessed 1362271 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362271
Number of alignments with a unique best hit from the different alignments: 91132
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1893056
Total methylated C's in CpG context: 313684
Total methylated C's in CHG context: 282681
Total methylated C's in CHH context: 901270
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35342
Total unmethylated C's in CHG context: 143669
Total unmethylated C's in CHH context: 216410
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 66.3%
C methylated in CHH context: 80.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1182471
Sequences did not map uniquely: 88668
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46956 ((converted) top strand)
CT/GA: 44176 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1234788 (90.64%) aligned 0 times
53487 (3.93%) aligned exactly 1 time
73997 (5.43%) aligned >1 times
9.36% overall alignment rate
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1232847 (90.50%) aligned 0 times
54395 (3.99%) aligned exactly 1 time
75030 (5.51%) aligned >1 times
9.50% overall alignment rateProcessed 1362272 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362272
Number of alignments with a unique best hit from the different alignments: 91161
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1893105
Total methylated C's in CpG context: 314457
Total methylated C's in CHG context: 282249
Total methylated C's in CHH context: 901965
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 34745
Total unmethylated C's in CHG context: 143346
Total unmethylated C's in CHH context: 216343
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.1%
C methylated in CHG context: 66.3%
C methylated in CHH context: 80.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1182163
Sequences did not map uniquely: 88948
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46691 ((converted) top strand)
CT/GA: 44470 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1235150 (90.67%) aligned 0 times
53264 (3.91%) aligned exactly 1 time
73857 (5.42%) aligned >1 times
9.33% overall alignment rate
1362271 reads; of these:
1362271 (100.00%) were unpaired; of these:
1232508 (90.47%) aligned 0 times
54313 (3.99%) aligned exactly 1 time
75450 (5.54%) aligned >1 times
9.53% overall alignment rateProcessed 1362271 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362271
Number of alignments with a unique best hit from the different alignments: 90998
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1885157
Total methylated C's in CpG context: 314544
Total methylated C's in CHG context: 281504
Total methylated C's in CHH context: 892363
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 35372
Total unmethylated C's in CHG context: 144228
Total unmethylated C's in CHH context: 217146
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 66.1%
C methylated in CHH context: 80.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1182257
Sequences did not map uniquely: 89016
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46783 ((converted) top strand)
CT/GA: 44215 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1233135 (90.52%) aligned 0 times
54230 (3.98%) aligned exactly 1 time
74907 (5.50%) aligned >1 times
9.48% overall alignment rate
1362272 reads; of these:
1362272 (100.00%) were unpaired; of these:
1235597 (90.70%) aligned 0 times
53411 (3.92%) aligned exactly 1 time
73264 (5.38%) aligned >1 times
9.30% overall alignment rateProcessed 1362272 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1362272
Number of alignments with a unique best hit from the different alignments: 90691
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1886081
Total methylated C's in CpG context: 311978
Total methylated C's in CHG context: 281671
Total methylated C's in CHH context: 895813
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 35994
Total unmethylated C's in CHG context: 143743
Total unmethylated C's in CHH context: 216882
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.7%
C methylated in CHG context: 66.2%
C methylated in CHH context: 80.5%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 1182990
Sequences did not map uniquely: 88591
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 46493 ((converted) top strand)
CT/GA: 44198 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8 trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_ACAGTG_L001_R1_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ACAGTG_L001_R1_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 12260444
Number of alignments with a unique best hit from the different alignments: 819748
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 17032078
Total methylated C's in CpG context: 2827873
Total methylated C's in CHG context: 2537021
Total methylated C's in CHH context: 8087889
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 320249
Total unmethylated C's in CHG context: 1299451
Total unmethylated C's in CHH context: 1959595
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.8%
C methylated in CHG context: 66.1%
C methylated in CHH context: 80.5%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...
====================
Bismark run complete
====================Sequences with no alignments under any condition: 10640673
Sequences did not map uniquely: 800023
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 421342 ((converted) top strand)
CT/GA: 398406 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_ACAGTG_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_ATCACG_R1.fastq
Files to be analysed:
trimmed-2112_lane1_ATCACG_R1.fastqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.1 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 4424 and offset 9
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.9 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.2 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.6 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.5 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.7 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.3 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.4 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_ATCACG_R1.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_ATCACG_R1.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_ATCACG_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_ATCACG_R1.fastq.temp.8 to trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.5 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.7 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.6 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.4 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.3 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.2 (3153552 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.8 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.9 (3153551 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_ATCACG_R1.fastq.temp.1 (3153552 sequences in total)
Input file is trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1406:2157_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTTATTAATTAATTATAAATTAAATTATTTTTAATATGATAATATTATATAAAATAAAATATTTATTTTTATTAATTATATTAATTTTTATTTATTAATT CCCFFFFFHHGHHJIIJIJJJJIJJJJJJJIJJJJJJJJIJJJJJJJFIJJIGIJJJJE@C@GHGDHIIHJIHHG?EHFFFFFFFEEEEEEDDDFDDDDD? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1393:2105_1:N:0:ATCACG 4 * 0 0 * * 0 0 AATTATTTTATAAAAAAATAAAAATAAATTATTAATTAATTATTTATTTATATATATATTTTAATAATTTATAATAAAATATAAAATAATTTATTTTTATA ??@DDFFFGBDHDGGIBHGFGIIIDIGIIIDIIIGHDHIIGII>BDGCEGHHGIGCEAD@CEEHHFHF?BACC>>@CBBDDDDDCCCABDBCAACCDCDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1460:2184_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATAATTTGTTGAATATTGATTAGAAAAAGAGGGAAATTTGGATTATAGTATTTATGGGTGTTTAAATTATTTTAATTTAGGAAAATTTTTATGTTATTTT @@?DFFFFDHDHDIIICHIFIBEFGGIGIIIH=DHHCH@HIEHFHGIGHBFHFGEGHG@7;:A@CECDDFDCDCC;CEDEACC@?CCC:>CDDCDFCDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1477:2106_1:N:0:ATCACG 0 KV918323.1_CT_converted 4041463 0 63M * 0 0 GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTAGGGTTAGGG =?@DDDBDHAADFEE2:AFGHFDGGGGC:???D:?3))B09)?BG8(BBB;8A4(;==;=;7; AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:51T11 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1346:2124_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATTAAAAAAAATTTTTATTTTTATTTATGTTATTGAAAATGAAAATAAATTTAAAAATATAATTATTTTGTTTGTTTATTTGTTTATTTATTT CCCFFFFDFHHHHJJJJJJJIJJJJJJJJJJJJJJJJHIJJJJGIJJJJHHHFFFEEECCCECDDDDDDDCDDDDCCDDDDDABDDEDDDDDDDEDDDEDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1442:2090_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATATGAAAATATAATTGATGTAAATGTATTTGTTATTGATTATTAAAATATATTATTAATAAAATATAATTATAAATTAAATAATAAAAATAT CCCFFFFDDFHHFEHIIIICHIBDFHIE:BFGHG>HBED@F88;DHE<?DCEEEDACC;@;CC;>CC>@>CCDC@>@CCDDDCDE@>CDDDDDDA?ADDB@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1222:2147_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTATATAAATATTAAATTAATTTTTTTTATAAATTTATATATTATTGAATATTATTATTTAAATAATAAAATTATTGATTTTTTTATGTTTTTAAAATTTT @@<D?DB;BFDFB@;F@CEDGIIGEHHIGGG=8CFIII>FHII>GIE06B?FD=BG:BHGC7=@GA>7@>7AHHC3?235<@?BCBB=BBBBB<AA::@CA YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1471:2206_1:N:0:ATCACG 4 * 0 0 * * 0 0 AATATATTTTAGTGTATGTATGTTTGTTAGAGGTAAGGGTTTGATATTGTATTTGAGATTGTAGTTTAGGTAGGGTTTTTTTTTTTTTAGTTAATAGTTGT @@@DFFFDHGHHF@HGGGHGIJIIJIJJJJJIFHGGJHI8BDFHIIGIIHIIIIEGIBGHIHGHCHHHHDFFECC=AAACCCDCDCCDDDBBDDDDD4@@@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1297:2201_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTATAATTAATGATGTAAAATAGTGTTTTTTAATTTTTAAATTTTGTAATATAAAAATATTTTAAGATTAATTAATAATATTAGAATTATTAAAAATATT @CCFFFFFGGHGHHJICEHJJJJJCDHIIIIIJGJJJJJIJIJJJJJJIHIGHCFGIIHJJJJJIGHEGIGEFHDCEHGHFHHHG@HFFFFFB>>CEECDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1471:2206_1:N:0:ATCACG 16 KV918251.1_GA_converted 2456212 0 101M * 0 0 ACAACTATTAACTAAAAAAAAAAAAACCCTACCTAAACTACAATCTCAAATACAATATCAAACCCTTACCTCTAACAAACATACATACACTAAAATATATT @@@4DDDDDBBDDDCCDCDCCCAAA=CCEFFDHHHHCHGHIHGBIGEIIIIHIIGIIHFDB8IHJGGHFIJJJJJIJIIJIGHGGGH@FHHGHDFFFD@@@ AS:i:-12 XS:i:-18 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:36C31T32 YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1297:2201_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTATAATTAATGATGTAAAATAGTGTTTTTTAATTTTTAAATTTTGTAATATAAAAATATTTTAAGATTAATTAATAATATTAGAATTATTAAAAATATT @CCFFFFFGGHGHHJICEHJJJJJCDHIIIIIJGJJJJJIJIJJJJJJIHIGHCFGIIHJJJJJIGHEGIGEFHDCEHGHFHHHG@HFFFFFB>>CEECDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1406:2157_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTTATTAATTAATTATAAATTAAATTATTTTTAATATGATAATATTATATAAAATAAAATATTTATTTTTATTAATTATATTAATTTTTATTTATTAATT CCCFFFFFHHGHHJIIJIJJJJIJJJJJJJIJJJJJJJJIJJJJJJJFIJJIGIJJJJE@C@GHGDHIIHJIHHG?EHFFFFFFFEEEEEEDDDFDDDDD? YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1477:2106_1:N:0:ATCACG 16 KV918252.1_GA_converted 1220 0 63M * 0 0 CCCTAACCCTACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC ;7;=;==;(4A8;BBB(8GB?)90B))3?:D???:CGGGGDFHGFA:2EEFDAAHDBDDD@?= AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:11A51 YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1460:2184_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATAATTTGTTGAATATTGATTAGAAAAAGAGGGAAATTTGGATTATAGTATTTATGGGTGTTTAAATTATTTTAATTTAGGAAAATTTTTATGTTATTTT @@?DFFFFDHDHDIIICHIFIBEFGGIGIIIH=DHHCH@HIEHFHGIGHBFHFGEGHG@7;:A@CECDDFDCDCC;CEDEACC@?CCC:>CDDCDFCDDDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1442:2090_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATATGAAAATATAATTGATGTAAATGTATTTGTTATTGATTATTAAAATATATTATTAATAAAATATAATTATAAATTAAATAATAAAAATAT CCCFFFFDDFHHFEHIIIICHIBDFHIE:BFGHG>HBED@F88;DHE<?DCEEEDACC;@;CC;>CC>@>CCDC@>@CCDDDCDE@>CDDDDDDA?ADDB@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1346:2124_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATTAAAAAAAATTTTTATTTTTATTTATGTTATTGAAAATGAAAATAAATTTAAAAATATAATTATTTTGTTTGTTTATTTGTTTATTTATTT CCCFFFFDFHHHHJJJJJJJIJJJJJJJJJJJJJJJJHIJJJJGIJJJJHHHFFFEEECCCECDDDDDDDCDDDDCCDDDDDABDDEDDDDDDDEDDDEDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.8
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.6
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.9
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.7
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.4
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.2
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.5
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1393:2105_1:N:0:ATCACG 4 * 0 0 * * 0 0 AATTATTTTATAAAAAAATAAAAATAAATTATTAATTAATTATTTATTTATATATATATTTTAATAATTTATAATAAAATATAAAATAATTTATTTTTATA ??@DDFFFGBDHDGGIBHGFGIIIDIGIIIDIIIGHDHIIGII>BDGCEGHHGIGCEAD@CEEHHFHF?BACC>>@CBBDDDDDCCCABDBCAACCDCDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1222:2147_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTATATAAATATTAAATTAATTTTTTTTATAAATTTATATATTATTGAATATTATTATTTAAATAATAAAATTATTGATTTTTTTATGTTTTTAAAATTTT @@<D?DB;BFDFB@;F@CEDGIIGEHHIGGG=8CFIII>FHII>GIE06B?FD=BG:BHGC7=@GA>7@>7AHHC3?235<@?BCBB=BBBBB<AA::@CA YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.3
Reading in the sequence file trimmed-2112_lane1_ATCACG_R1.fastq.temp.1
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1101:19134:34984_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1101:19134:34984_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1101:19134:34984_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1101:19134:34984_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:3110:63301_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:3110:63301_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:3110:63301_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:3110:63301_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:2454:84014_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:2454:84014_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:2454:84014_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:2454:84014_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:12245:88213_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:12245:88213_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:12245:88213_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:12245:88213_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1114:10924:89327_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1114:10924:89327_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1114:10924:89327_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1114:10924:89327_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:4678:56948_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:4678:56948_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:4678:56948_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1206:4678:56948_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1647:26486_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1647:26486_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1647:26486_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1647:26486_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4638:39151_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4638:39151_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4638:39151_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4638:39151_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4231:58602_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4231:58602_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4231:58602_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:4231:58602_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1112:54523_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1112:54523_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1112:54523_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1112:54523_1:N:0:ATCACG' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1302:5938:29900_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1302:5938:29900_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1302:5938:29900_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1302:5938:29900_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21122:92632_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21122:92632_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21122:92632_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21122:92632_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1312:13112:3670_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1312:13112:3670_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1312:13112:3670_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1312:13112:3670_1:N:0:ATCACG' because it was < 2 characters long
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:1314:6069:93808_1:N:0:ATCACG KV918297.1 2638025
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:3219:98750_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:3219:98750_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:3219:98750_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:3219:98750_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:14940:68781_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:14940:68781_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:14940:68781_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:14940:68781_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11600:95027_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11600:95027_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11600:95027_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11600:95027_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:9974:15610_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:9974:15610_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:9974:15610_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:9974:15610_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:20964:11379_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:20964:11379_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:20964:11379_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:20964:11379_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:17457:19910_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:17457:19910_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:17457:19910_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:17457:19910_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:5607:85747_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:5607:85747_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:5607:85747_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:5607:85747_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:1312:3731_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:1312:3731_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:1312:3731_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:1312:3731_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:14784:10097_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:14784:10097_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:14784:10097_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2111:14784:10097_1:N:0:ATCACG' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:4214:96197_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:4214:96197_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:4214:96197_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:4214:96197_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2203:2670:87092_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2203:2670:87092_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2203:2670:87092_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2203:2670:87092_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2207:4181:51445_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2207:4181:51445_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2207:4181:51445_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2207:4181:51445_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:13300:71607_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:13300:71607_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:13300:71607_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:13300:71607_1:N:0:ATCACG' because it was < 2 characters long
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:2216:8056:13122_1:N:0:ATCACG KV918391.1 1
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:10949:30966_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:10949:30966_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:10949:30966_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:10949:30966_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:17902:83807_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:17902:83807_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:17902:83807_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:17902:83807_1:N:0:ATCACG' because it was < 2 characters long
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2314:18540:71196_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2314:18540:71196_1:N:0:ATCACG' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2314:18540:71196_1:N:0:ATCACG' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2314:18540:71196_1:N:0:ATCACG' because it was < 2 characters long
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2899588 (91.95%) aligned 0 times
150475 (4.77%) aligned exactly 1 time
103488 (3.28%) aligned >1 times
8.05% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895202 (91.81%) aligned 0 times
152980 (4.85%) aligned exactly 1 time
105369 (3.34%) aligned >1 times
8.19% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 258934
Mapping efficiency: 8.2%Sequences with no alignments under any condition: 2761353
Sequences did not map uniquely: 133264
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132459 ((converted) top strand)
CT/GA: 126474 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5006526
Total methylated C's in CpG context: 622113
Total methylated C's in CHG context: 793082
Total methylated C's in CHH context: 2677605
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93492
Total unmethylated C's in CHG context: 258556
Total unmethylated C's in CHH context: 561678
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 86.9%
C methylated in CHG context: 75.4%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895793 (91.83%) aligned 0 times
152315 (4.83%) aligned exactly 1 time
105443 (3.34%) aligned >1 times
8.17% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2899572 (91.95%) aligned 0 times
150412 (4.77%) aligned exactly 1 time
103567 (3.28%) aligned >1 times
8.05% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 258569
Mapping efficiency: 8.2%Sequences with no alignments under any condition: 2761839
Sequences did not map uniquely: 133143
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 131987 ((converted) top strand)
CT/GA: 126582 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5004284
Total methylated C's in CpG context: 623269
Total methylated C's in CHG context: 794033
Total methylated C's in CHH context: 2675169
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 93316
Total unmethylated C's in CHG context: 257902
Total unmethylated C's in CHH context: 560595
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.0%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
C methylated in Unknown context (CN or CHN): 100.0%
3153552 reads; of these:
3153552 (100.00%) were unpaired; of these:
2900056 (91.96%) aligned 0 times
149848 (4.75%) aligned exactly 1 time
103648 (3.29%) aligned >1 times
8.04% overall alignment rate
3153552 reads; of these:
3153552 (100.00%) were unpaired; of these:
2895972 (91.83%) aligned 0 times
152407 (4.83%) aligned exactly 1 time
105173 (3.34%) aligned >1 times
8.17% overall alignment rateProcessed 3153552 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153552
Number of alignments with a unique best hit from the different alignments: 258236
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4992357
Total methylated C's in CpG context: 623745
Total methylated C's in CHG context: 792964
Total methylated C's in CHH context: 2669080
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93037
Total unmethylated C's in CHG context: 256828
Total unmethylated C's in CHH context: 556703
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.0%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2762414
Sequences did not map uniquely: 132902
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132040 ((converted) top strand)
CT/GA: 126196 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895323 (91.81%) aligned 0 times
152817 (4.85%) aligned exactly 1 time
105411 (3.34%) aligned >1 times
8.19% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2900661 (91.98%) aligned 0 times
149817 (4.75%) aligned exactly 1 time
103073 (3.27%) aligned >1 times
8.02% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 258668
Mapping efficiency: 8.2%Sequences with no alignments under any condition: 2762306
Sequences did not map uniquely: 132577
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132642 ((converted) top strand)
CT/GA: 126026 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5003052
Total methylated C's in CpG context: 624380
Total methylated C's in CHG context: 793717
Total methylated C's in CHH context: 2674941
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 92924
Total unmethylated C's in CHG context: 258120
Total unmethylated C's in CHH context: 558970
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.0%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
3153552 reads; of these:
3153552 (100.00%) were unpaired; of these:
2895194 (91.81%) aligned 0 times
152935 (4.85%) aligned exactly 1 time
105423 (3.34%) aligned >1 times
8.19% overall alignment rate
3153552 reads; of these:
3153552 (100.00%) were unpaired; of these:
2900435 (91.97%) aligned 0 times
150035 (4.76%) aligned exactly 1 time
103082 (3.27%) aligned >1 times
8.03% overall alignment rateProcessed 3153552 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153552
Number of alignments with a unique best hit from the different alignments: 259254
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5017316
Total methylated C's in CpG context: 625980
Total methylated C's in CHG context: 795909
Total methylated C's in CHH context: 2680783
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 94002
Total unmethylated C's in CHG context: 258506
Total unmethylated C's in CHH context: 562136
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 86.9%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2761896
Sequences did not map uniquely: 132402
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132969 ((converted) top strand)
CT/GA: 126285 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895670 (91.82%) aligned 0 times
152227 (4.83%) aligned exactly 1 time
105654 (3.35%) aligned >1 times
8.18% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2900573 (91.98%) aligned 0 times
149582 (4.74%) aligned exactly 1 time
103396 (3.28%) aligned >1 times
8.02% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 258443
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5001380
Total methylated C's in CpG context: 622533
Total methylated C's in CHG context: 792127
Total methylated C's in CHH context: 2673416
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93664
Total unmethylated C's in CHG context: 259477
Total unmethylated C's in CHH context: 560163
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 86.9%
C methylated in CHG context: 75.3%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2762339
Sequences did not map uniquely: 132769
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132404 ((converted) top strand)
CT/GA: 126038 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2894900 (91.80%) aligned 0 times
152875 (4.85%) aligned exactly 1 time
105776 (3.35%) aligned >1 times
8.20% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2899831 (91.95%) aligned 0 times
150246 (4.76%) aligned exactly 1 time
103474 (3.28%) aligned >1 times
8.05% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 259352
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5017829
Total methylated C's in CpG context: 625038
Total methylated C's in CHG context: 794784
Total methylated C's in CHH context: 2686444
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 92655
Total unmethylated C's in CHG context: 257459
Total unmethylated C's in CHH context: 561449
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.1%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2761175
Sequences did not map uniquely: 133024
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132819 ((converted) top strand)
CT/GA: 126533 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895110 (91.80%) aligned 0 times
152909 (4.85%) aligned exactly 1 time
105532 (3.35%) aligned >1 times
8.20% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2899579 (91.95%) aligned 0 times
150346 (4.77%) aligned exactly 1 time
103626 (3.29%) aligned >1 times
8.05% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 259479
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5017551
Total methylated C's in CpG context: 626213
Total methylated C's in CHG context: 795620
Total methylated C's in CHH context: 2678770
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93947
Total unmethylated C's in CHG context: 259874
Total unmethylated C's in CHH context: 563127
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.0%
C methylated in CHG context: 75.4%
C methylated in CHH context: 82.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2761140
Sequences did not map uniquely: 132932
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132867 ((converted) top strand)
CT/GA: 126612 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2895633 (91.82%) aligned 0 times
152476 (4.84%) aligned exactly 1 time
105442 (3.34%) aligned >1 times
8.18% overall alignment rate
3153551 reads; of these:
3153551 (100.00%) were unpaired; of these:
2899509 (91.94%) aligned 0 times
150282 (4.77%) aligned exactly 1 time
103760 (3.29%) aligned >1 times
8.06% overall alignment rateProcessed 3153551 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3153551
Number of alignments with a unique best hit from the different alignments: 258808
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5004713
Total methylated C's in CpG context: 623814
Total methylated C's in CHG context: 793428
Total methylated C's in CHH context: 2677073
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93881
Total unmethylated C's in CHG context: 257997
Total unmethylated C's in CHH context: 558520
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 86.9%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2761535
Sequences did not map uniquely: 133208
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 132180 ((converted) top strand)
CT/GA: 126628 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_ATCACG_R1.fastq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...trimmed-2112_lane1_ATCACG_R1.fastq.temp.2 trimmed-2112_lane1_ATCACG_R1.fastq.temp.3 trimmed-2112_lane1_ATCACG_R1.fastq.temp.4 trimmed-2112_lane1_ATCACG_R1.fastq.temp.5 trimmed-2112_lane1_ATCACG_R1.fastq.temp.6 trimmed-2112_lane1_ATCACG_R1.fastq.temp.7 trimmed-2112_lane1_ATCACG_R1.fastq.temp.8 trimmed-2112_lane1_ATCACG_R1.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_ATCACG_R1_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_ATCACG_R1_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 28381961
Number of alignments with a unique best hit from the different alignments: 2329743
Mapping efficiency: 8.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 45065008
Total methylated C's in CpG context: 5617085
Total methylated C's in CHG context: 7145664
Total methylated C's in CHH context: 24093281
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 840918
Total unmethylated C's in CHG context: 2324719
Total unmethylated C's in CHH context: 5043341
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.0%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.7%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...
====================
Bismark run complete
====================Sequences with no alignments under any condition: 24855997
Sequences did not map uniquely: 1196221
Sequences which were discarded because genomic sequence could not be extracted: 2
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 1192367 ((converted) top strand)
CT/GA: 1137374 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_ATCACG_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_ATCACG_R1.fastq.temp.9_bismark_bt2_SE_report.txt Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_CAGATC_R1.fastq
Files to be analysed:
trimmed-2112_lane1_CAGATC_R1.fastqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.1 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.6 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.7 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.4 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.8 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.5 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.3 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 14603 and offset 9
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.9 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_CAGATC_R1.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_CAGATC_R1.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_CAGATC_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_CAGATC_R1.fastq.temp.2 to trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.9 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.7 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.4 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.5 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.8 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.6 (3474106 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.3 (3474107 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.1 (3474107 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1464:2079_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGNTTTTTTTAATTATTTTAAAATTGAAAATATTAAAATATATTTTAATATTAATTTTATTGATAAAATTATAAATTATATATATATATTTTTTTTTATTT ==#4=BDDAFDHAHGIGIJIIGJGIIBHIIIGIIGIIG<G<@@GIIIIIIJJIJIIJJJJJGIHFFFDA>CADED@CBDDBD:ADDEE>@ACCDDCDDCCD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1494:2179_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTTTTTTTATTTAATTAATTATAATTTTTAATAAATATTTAAAATTGTGATTAAAATATTGTTTTTTTGATTTTTAAAATTTGTAATTAGATTGGAAGA 1=BDDDFFHHHHHJJJJJJJJJIJJJJJJJJJJJJJJJJJIJJJJJJJJJJIGIEHIIJIHHHFFDDEEDBBBDD@CCDDDEDDDDBBDEDDDDDDDDDD< YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1422:2188_1:N:0:CAGATC 4 * 0 0 * * 0 0 AATAAATTATAAATAAATGGGTAATATATTTTTATTATATAATAATTGTATAATTTTTGTTGTTGATAAATGTTTTGATTTTGTTTAATTTTATAAAATTT @@<DDDFFHHHHHJJJJJJIIJJIIJIDHGEGHIJIJJGJIIJJJJJJJJJJFIIEIJEEHFADDBBDDDDDCDD<BBDDDDBDDDBDDDDDDDDCEDCDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1271:2088_1:N:0:CAGATC 4 * 0 0 * * 0 0 GGTTGGTTGTTTGAATTTTAGTTGTGATAGATTTAAGTTGTTAAAATAGGTAGTGATAGTTTTATTGTTAAATGTTTGGTAATAGGTATGTTGTTTGTTTG =?:ABDA;FCFHFGGGHHIFGDHHHIFIIJGIJIHCGFGHIGGDDEGHHI??B?EBDFD8BFCFGHHFEFFHHCC=DAE?CAEHH=BDDFFDE@CCC@BC? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1323:2145_1:N:0:CAGATC 4 * 0 0 * * 0 0 GTTTGTTTGTTTATGGTTTGATTTGTTTTTTAGGGTTGTTTGGTATAGGTATGTTGTTTGTTTGTTTATGATTTATT CCCFFDFFGFHHHGHIAFGIFHEIIHHIJJJHGGDFHIFCHHIFCFGGICFGGCGCGHHIEEHE?CDFEDCCDEC6@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1391:2128_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGTGATTTTTTGTTATTAATTAATGATTTTGTTAAAAATTGATGTGTTGGATGAGGAGAAGTGGTTTAATATGTTTGGTATGTTTGTTAAGGATTGGTTTA @<@?DDDDHDFH<GEGIIIIIIIIIGHAGHG@GFHDHGH>GAFEHG@HII@EHHHHDDBDC>CC?=;ACDEC@C>5:<CCCB<?B9<BB9AC<ACBB>AA3 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_CAGATC_R1.fastq.temp.2 (3474107 sequences in total)
Input file is trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1311:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TANATATTTTAATAAAATAATAATATATAAATTATTATTGTATATATATTTTAATAAAATAATAATATATAAATTATTATAATATATATATTTAAATAAAA @?#4ADDDGHHHHJIIJJJIJJJJJIJIJHIJJJJJIJJIHHGIJJJJJJJJIJGIJIJGHHHFHGHHFFFFFEECCEEDDCDCDDDDDDDDDCADCCB<A YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1170:2189_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTGTAAATTATAAAAAAATTTATTTTTTATGTAAAAAAATTAAAAAAATAAATAAAAATTGTGAATTTTTAAAAAAATTTATTATATTATTTTTTTTTT @?@DDDDFG>FDHIGIGHHGGEHGGII@GHIIHIGGGEIGGIIHHIHGFC>CCDDDBB?BBCBDD;@BBD:A9A828>BBCDDDDEEDCCD@CDCCCCCCC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1464:2079_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGNTTTTTTTAATTATTTTAAAATTGAAAATATTAAAATATATTTTAATATTAATTTTATTGATAAAATTATAAATTATATATATATATTTTTTTTTATTT ==#4=BDDAFDHAHGIGIJIIGJGIIBHIIIGIIGIIG<G<@@GIIIIIIJJIJIIJJJJJGIHFFFDA>CADED@CBDDBD:ADDEE>@ACCDDCDDCCD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1494:2179_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTTTTTTTATTTAATTAATTATAATTTTTAATAAATATTTAAAATTGTGATTAAAATATTGTTTTTTTGATTTTTAAAATTTGTAATTAGATTGGAAGA 1=BDDDFFHHHHHJJJJJJJJJIJJJJJJJJJJJJJJJJJIJJJJJJJJJJIGIEHIIJIHHHFFDDEEDBBBDD@CCDDDEDDDDBBDEDDDDDDDDDD< YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1323:2145_1:N:0:CAGATC 4 * 0 0 * * 0 0 GTTTGTTTGTTTATGGTTTGATTTGTTTTTTAGGGTTGTTTGGTATAGGTATGTTGTTTGTTTGTTTATGATTTATT CCCFFDFFGFHHHGHIAFGIFHEIIHHIJJJHGGDFHIFCHHIFCFGGICFGGCGCGHHIEEHE?CDFEDCCDEC6@ YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1271:2088_1:N:0:CAGATC 4 * 0 0 * * 0 0 GGTTGGTTGTTTGAATTTTAGTTGTGATAGATTTAAGTTGTTAAAATAGGTAGTGATAGTTTTATTGTTAAATGTTTGGTAATAGGTATGTTGTTTGTTTG =?:ABDA;FCFHFGGGHHIFGDHHHIFIIJGIJIHCGFGHIGGDDEGHHI??B?EBDFD8BFCFGHHFEFFHHCC=DAE?CAEHH=BDDFFDE@CCC@BC? YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1422:2188_1:N:0:CAGATC 4 * 0 0 * * 0 0 AATAAATTATAAATAAATGGGTAATATATTTTTATTATATAATAATTGTATAATTTTTGTTGTTGATAAATGTTTTGATTTTGTTTAATTTTATAAAATTT @@<DDDFFHHHHHJJJJJJIIJJIIJIDHGEGHIJIJJGJIIJJJJJJJJJJFIIEIJEEHFADDBBDDDDDCDD<BBDDDDBDDDBDDDDDDDDCEDCDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1391:2128_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGTGATTTTTTGTTATTAATTAATGATTTTGTTAAAAATTGATGTGTTGGATGAGGAGAAGTGGTTTAATATGTTTGGTATGTTTGTTAAGGATTGGTTTA @<@?DDDDHDFH<GEGIIIIIIIIIGHAGHG@GFHDHGH>GAFEHG@HII@EHHHHDDBDC>CC?=;ACDEC@C>5:<CCCB<?B9<BB9AC<ACBB>AA3 YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1311:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TANATATTTTAATAAAATAATAATATATAAATTATTATTGTATATATATTTTAATAAAATAATAATATATAAATTATTATAATATATATATTTAAATAAAA @?#4ADDDGHHHHJIIJJJIJJJJJIJIJHIJJJJJIJJIHHGIJJJJJJJJIJGIJIJGHHHFHGHHFFFFFEECCEEDDCDCDDDDDDDDDCADCCB<A YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1170:2189_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTGTAAATTATAAAAAAATTTATTTTTTATGTAAAAAAATTAAAAAAATAAATAAAAATTGTGAATTTTTAAAAAAATTTATTATATTATTTTTTTTTT @?@DDDDFG>FDHIGIGHHGGEHGGII@GHIIHIGGGEIGGIIHHIHGFC>CCDDDBB?BBCBDD;@BBD:A9A828>BBCDDDDEEDCCD@CDCCCCCCC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1357:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTNTGTAGATGTTATTTTGAAATATTTTATAGAGGTGTGAATTTTTTTAGGTTTTGAGTTTTTTTTTTTGGAGAAGATAGAAATTAAATTAAAAAATAGTA @@#4=ABDHFFFHIIIIIG@ECHIIGIIIIIIGGGDFBFGHCHGGGGIIIHIIIIIAB5;CEHHCEEFFDCD@;255:ACC@CCDB<BDDDDCCCBB(9?9 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.5
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.6
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.3
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.7
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.8
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.1
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.9
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.4
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1357:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTNTGTAGATGTTATTTTGAAATATTTTATAGAGGTGTGAATTTTTTTAGGTTTTGAGTTTTTTTTTTTGGAGAAGATAGAAATTAAATTAAAAAATAGTA @@#4=ABDHFFFHIIIIIG@ECHIIGIIIIIIGGGDFBFGHCHGGGGIIIHIIIIIAB5;CEHHCEEFFDCD@;255:ACC@CCDB<BDDDDCCCBB(9?9 YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_CAGATC_R1.fastq.temp.2
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:20622:48261_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:20622:48261_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:20622:48261_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:20622:48261_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:16151:59140_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:16151:59140_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:16151:59140_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:16151:59140_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:17731:56324_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:17731:56324_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:17731:56324_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1104:17731:56324_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:15230:93418_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:15230:93418_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:15230:93418_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:15230:93418_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:12184:8723_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:12184:8723_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:12184:8723_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:12184:8723_1:N:0:CAGATC' because it was < 2 characters long
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1213:1337:8589_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1213:1337:8589_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1213:1337:8589_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1213:1337:8589_1:N:0:CAGATC' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:1593:23757_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:1593:23757_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:1593:23757_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:1593:23757_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:20816:63335_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:20816:63335_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:20816:63335_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1303:20816:63335_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:1662:12898_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:1662:12898_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:1662:12898_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:1662:12898_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21268:81701_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21268:81701_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21268:81701_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:21268:81701_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:19760:52595_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:19760:52595_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:19760:52595_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:19760:52595_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20863:96510_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20863:96510_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20863:96510_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1304:20863:96510_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:20319:83539_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:20319:83539_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:20319:83539_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:20319:83539_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:18889:96886_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:18889:96886_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:18889:96886_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:18889:96886_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:19943:85936_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:19943:85936_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:19943:85936_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:19943:85936_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11021:73353_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11021:73353_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11021:73353_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2106:11021:73353_1:N:0:CAGATC' because it was < 2 characters long
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:14426:25880_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:14426:25880_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:14426:25880_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:14426:25880_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:8441:63937_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:8441:63937_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:8441:63937_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:8441:63937_1:N:0:CAGATC' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7278:62027_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7278:62027_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7278:62027_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7278:62027_1:N:0:CAGATC' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:18046:37999_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:18046:37999_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:18046:37999_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:18046:37999_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:8818:17284_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:8818:17284_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:8818:17284_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2114:8818:17284_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2202:1967:66346_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2202:1967:66346_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2202:1967:66346_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2202:1967:66346_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2205:6485:78695_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2205:6485:78695_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2205:6485:78695_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2205:6485:78695_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:4782:52687_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:4782:52687_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:4782:52687_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:4782:52687_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:19735:9843_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:19735:9843_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:19735:9843_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:19735:9843_1:N:0:CAGATC' because it was < 2 characters long
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
3474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3240961 (93.29%) aligned 0 times
119852 (3.45%) aligned exactly 1 time
113294 (3.26%) aligned >1 times
6.71% overall alignment rate
3474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3236596 (93.16%) aligned 0 times
122123 (3.52%) aligned exactly 1 time
115388 (3.32%) aligned >1 times
6.84% overall alignment rateProcessed 3474107 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474107
Number of alignments with a unique best hit from the different alignments: 205192
Mapping efficiency: 5.9%Sequences with no alignments under any condition: 3130006
Sequences did not map uniquely: 138909
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105420 ((converted) top strand)
CT/GA: 99772 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4142931
Total methylated C's in CpG context: 608304
Total methylated C's in CHG context: 700777
Total methylated C's in CHH context: 2237763
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 63021
Total unmethylated C's in CHG context: 188183
Total unmethylated C's in CHH context: 344883
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.6%
C methylated in CHG context: 78.8%
C methylated in CHH context: 86.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:17178:97384_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:17178:97384_1:N:0:CAGATC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:17178:97384_1:N:0:CAGATC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:17178:97384_1:N:0:CAGATC' because it was < 2 characters long
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3236983 (93.17%) aligned 0 times
122098 (3.51%) aligned exactly 1 time
115025 (3.31%) aligned >1 times
6.83% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3241834 (93.31%) aligned 0 times
119773 (3.45%) aligned exactly 1 time
112499 (3.24%) aligned >1 times
6.69% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 205739
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4149621
Total methylated C's in CpG context: 610263
Total methylated C's in CHG context: 703475
Total methylated C's in CHH context: 2239160
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62981
Total unmethylated C's in CHG context: 188947
Total unmethylated C's in CHH context: 344795
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.6%
C methylated in CHG context: 78.8%
C methylated in CHH context: 86.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3130182
Sequences did not map uniquely: 138185
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105869 ((converted) top strand)
CT/GA: 99870 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3241309 (93.30%) aligned 0 times
119589 (3.44%) aligned exactly 1 time
113209 (3.26%) aligned >1 times
6.70% overall alignment rate
3474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3236880 (93.17%) aligned 0 times
121869 (3.51%) aligned exactly 1 time
115358 (3.32%) aligned >1 times
6.83% overall alignment rateProcessed 3474107 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474107
Number of alignments with a unique best hit from the different alignments: 205059
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4132861
Total methylated C's in CpG context: 608507
Total methylated C's in CHG context: 699779
Total methylated C's in CHH context: 2230956
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62379
Total unmethylated C's in CHG context: 187627
Total unmethylated C's in CHH context: 343613
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3130364
Sequences did not map uniquely: 138684
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105264 ((converted) top strand)
CT/GA: 99795 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3241157 (93.29%) aligned 0 times
119815 (3.45%) aligned exactly 1 time
113135 (3.26%) aligned >1 times
6.71% overall alignment rate
3474107 reads; of these:
3474107 (100.00%) were unpaired; of these:
3237204 (93.18%) aligned 0 times
121693 (3.50%) aligned exactly 1 time
115210 (3.32%) aligned >1 times
6.82% overall alignment rateProcessed 3474107 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474107
Number of alignments with a unique best hit from the different alignments: 204941
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4131230
Total methylated C's in CpG context: 607040
Total methylated C's in CHG context: 701441
Total methylated C's in CHH context: 2229120
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 62553
Total unmethylated C's in CHG context: 187370
Total unmethylated C's in CHH context: 343706
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.6%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 3130324
Sequences did not map uniquely: 138842
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105112 ((converted) top strand)
CT/GA: 99829 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3237446 (93.19%) aligned 0 times
121533 (3.50%) aligned exactly 1 time
115127 (3.31%) aligned >1 times
6.81% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3241768 (93.31%) aligned 0 times
119311 (3.43%) aligned exactly 1 time
113027 (3.25%) aligned >1 times
6.69% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 205057
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4137258
Total methylated C's in CpG context: 607128
Total methylated C's in CHG context: 702369
Total methylated C's in CHH context: 2235413
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62844
Total unmethylated C's in CHG context: 186696
Total unmethylated C's in CHH context: 342808
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.6%
C methylated in CHG context: 79.0%
C methylated in CHH context: 86.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3130923
Sequences did not map uniquely: 138126
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105265 ((converted) top strand)
CT/GA: 99792 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3237380 (93.19%) aligned 0 times
121596 (3.50%) aligned exactly 1 time
115130 (3.31%) aligned >1 times
6.81% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3241749 (93.31%) aligned 0 times
119096 (3.43%) aligned exactly 1 time
113261 (3.26%) aligned >1 times
6.69% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 205161
Mapping efficiency: 5.9%Sequences with no alignments under any condition: 3130715
Sequences did not map uniquely: 138230
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105434 ((converted) top strand)
CT/GA: 99727 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4138303
Total methylated C's in CpG context: 609156
Total methylated C's in CHG context: 701521
Total methylated C's in CHH context: 2231297
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62733
Total unmethylated C's in CHG context: 188522
Total unmethylated C's in CHH context: 345074
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.8%
C methylated in CHH context: 86.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3236312 (93.16%) aligned 0 times
122276 (3.52%) aligned exactly 1 time
115518 (3.33%) aligned >1 times
6.84% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3241088 (93.29%) aligned 0 times
119841 (3.45%) aligned exactly 1 time
113177 (3.26%) aligned >1 times
6.71% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 205282
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4142735
Total methylated C's in CpG context: 608922
Total methylated C's in CHG context: 701562
Total methylated C's in CHH context: 2238108
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62586
Total unmethylated C's in CHG context: 187413
Total unmethylated C's in CHH context: 344144
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3129762
Sequences did not map uniquely: 139062
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105429 ((converted) top strand)
CT/GA: 99853 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3236401 (93.16%) aligned 0 times
122077 (3.51%) aligned exactly 1 time
115628 (3.33%) aligned >1 times
6.84% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3241594 (93.31%) aligned 0 times
119266 (3.43%) aligned exactly 1 time
113246 (3.26%) aligned >1 times
6.69% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 204871
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4132000
Total methylated C's in CpG context: 606710
Total methylated C's in CHG context: 699763
Total methylated C's in CHH context: 2231452
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62236
Total unmethylated C's in CHG context: 187607
Total unmethylated C's in CHH context: 344232
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3130350
Sequences did not map uniquely: 138885
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105298 ((converted) top strand)
CT/GA: 99573 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3237116 (93.18%) aligned 0 times
122198 (3.52%) aligned exactly 1 time
114792 (3.30%) aligned >1 times
6.82% overall alignment rate
3474106 reads; of these:
3474106 (100.00%) were unpaired; of these:
3242148 (93.32%) aligned 0 times
119469 (3.44%) aligned exactly 1 time
112489 (3.24%) aligned >1 times
6.68% overall alignment rateProcessed 3474106 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3474106
Number of alignments with a unique best hit from the different alignments: 205633
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4153660
Total methylated C's in CpG context: 612141
Total methylated C's in CHG context: 705406
Total methylated C's in CHH context: 2242346
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61793
Total unmethylated C's in CHG context: 188136
Total unmethylated C's in CHH context: 343838
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.8%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3130628
Sequences did not map uniquely: 137845
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 105946 ((converted) top strand)
CT/GA: 99687 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_CAGATC_R1.fastq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...trimmed-2112_lane1_CAGATC_R1.fastq.temp.2 trimmed-2112_lane1_CAGATC_R1.fastq.temp.3 trimmed-2112_lane1_CAGATC_R1.fastq.temp.4 trimmed-2112_lane1_CAGATC_R1.fastq.temp.5 trimmed-2112_lane1_CAGATC_R1.fastq.temp.6 trimmed-2112_lane1_CAGATC_R1.fastq.temp.7 trimmed-2112_lane1_CAGATC_R1.fastq.temp.8 trimmed-2112_lane1_CAGATC_R1.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_CAGATC_R1_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_CAGATC_R1_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 31266957
Number of alignments with a unique best hit from the different alignments: 1846935
Mapping efficiency: 5.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 37260599
Total methylated C's in CpG context: 5478171
Total methylated C's in CHG context: 6316093
Total methylated C's in CHH context: 20115615
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 563126
Total unmethylated C's in CHG context: 1690501
Total unmethylated C's in CHH context: 3097093
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.9%
C methylated in CHH context: 86.7%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...Sequences with no alignments under any condition: 28173254
Sequences did not map uniquely: 1246768
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 949037 ((converted) top strand)
CT/GA: 897898 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_CAGATC_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_CAGATC_R1.fastq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_GCCAAT_L001_R1.fastq
Files to be analysed:
trimmed-2112_lane1_GCCAAT_L001_R1.fastqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 27777 and offset 9
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_GCCAAT_L001_R1.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_GCCAAT_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2 to trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9 (2312362 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1209:2236_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTGATTATTAAAAATTTAATAAATAAAATATATTTATTTATAATTATTTAAAATTATTATTAATTAATAAAAAATAAATTTTTATAAAATTTTATTTTT @@?FFDFFHFHHHIG@GFHC@HGFHHECD>FGGGIIGIIIIGGGGDG=FGIDBCGGIJIJGGGGIJHFEHF3?D;9@ACCCCCDDCDC>;CDDDDCDCDFD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1244:2170_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTAATTTTAATTTTTAAAATTTTAATTTTAATTTTAATATTAAAATTTTATTTTTAATATTTAAATTTTAAAATTTTAATATTAATTTTAATATAAATAA @@@FFFFFHHFH?GHIHIIDHAFHIIICGGHGHIDHB;DHIIA39?DBBFHGFG=F;CCEGIHHGFHEDFDECCC>CCCCCCCA?CC9ABCBCCC>CCCC? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1376:2154_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTTTTGAAATATTAATTGATTAAAATTTAGATAAATTTTGATTATATATATTTTAAATTAAATTATAAAAA @@@=DDFFHHHHHJGIJGJIIGHJJIGIIJIDIJJJHIGIJJBIJFIGIIIJJJJGFHEHFDFDCEEECDB YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3 (2312363 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1731:2078_1:N:0:GCCAAT 4 * 0 0 * * 0 0 AANAAATTATAAATAAATGGGTAATATATTTATATTTTTTTTATTTTTAAAATTTATTTTTATATATTTTATTAAAATTTAATAATATTTATTTTATAAAA CC#4ADDFHFHHHJIJJIJGIJGIIJJIIJIJIHIIJIIJJJJIJJJJIIEBAHGIIJIIJJJHHHHFFFFEEDD?BDCDCCEDDDDDDDDDDDDDCDCCD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1199:2076_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTNTATTTTTAGAGTGGTTTTTTTGGTATGATTTTTTTGTATTATTATGATATTGTTGTATATTTAGGTTGGAGGAGGTATTTTGGAAAAGAATAGATTGG CC#4ADDFHHGHHHIFHHIJJJJJJJHGJJJJJJJIJJJJJJIIHIIJJIJGIJIJJIIIIFIJJIIJ=DGF?CHEBFCDBEDDDD;<?CA?ACCDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8 (2312362 sequences in total)
Input file is trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2118_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTATTTATTTTGATTATTTATATTATATGTATTTATAATTATTGTTTTGAATTTTTTGTAATTATAAAATTTGAATTTTAATATATTTTAATTAATTGTTA @@@?BDDDF?FFDF@@GH>HIGGIIIGHF?DD=D9BGGIFB?C1BFHIFA';BBDCCC>9;BB@B<??BBACB(98?CCCCCCCCDCDC>CBC@CCB<>B9 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1209:2236_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTGATTATTAAAAATTTAATAAATAAAATATATTTATTTATAATTATTTAAAATTATTATTAATTAATAAAAAATAAATTTTTATAAAATTTTATTTTT @@?FFDFFHFHHHIG@GFHC@HGFHHECD>FGGGIIGIIIIGGGGDG=FGIDBCGGIJIJGGGGIJHFEHF3?D;9@ACCCCCDDCDC>;CDDDDCDCDFD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1244:2170_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTAATTTTAATTTTTAAAATTTTAATTTTAATTTTAATATTAAAATTTTATTTTTAATATTTAAATTTTAAAATTTTAATATTAATTTTAATATAAATAA @@@FFFFFHHFH?GHIHIIDHAFHIIICGGHGHIDHB;DHIIA39?DBBFHGFG=F;CCEGIHHGFHEDFDECCC>CCCCCCCA?CC9ABCBCCC>CCCC? YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1376:2154_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTTTTGAAATATTAATTGATTAAAATTTAGATAAATTTTGATTATATATATTTTAAATTAAATTATAAAAA @@@=DDFFHHHHHJGIJGJIIGHJJIGIIJIDIJJJHIGIJJBIJFIGIIIJJJJGFHEHFDFDCEEECDB YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1217:2174_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTTTTGTTTTATTTAATTTTTAAAAAAATTTTATTTTTTATTTGTTAAATTATATAATTTTATTTTTTTATTTAAAAAAATATATATTATTTTTATTAG @1?DDDDD<:DFHIIIFH>IHIBHIIDHIEGEGHIIGIGHIGGGGFGG=4=CHHIIID)7-;4;5?DE19;55-;;@C<ABB2:>CCC<<<28A@CC@A>: YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1195:2123_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TGGTTGTAATAAATTGGATTGAGTAAAGAGTTATTGTGGAAATGAGAAATATAAAGTTTGGTGGTAATTAAATATTGTTAGTTTAGTGTGAGAGTGTGAAA CC@FFFFFHHHHHJJHHGIIJIJJJJIIGIGIHHGIGIJGIGGIJGFDGGIJIIIJIJIIJFCH;DHGHHEFFFF?BDDDB@CCEDFDDDDC5@:@>CCAC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1731:2078_1:N:0:GCCAAT 4 * 0 0 * * 0 0 AANAAATTATAAATAAATGGGTAATATATTTATATTTTTTTTATTTTTAAAATTTATTTTTATATATTTTATTAAAATTTAATAATATTTATTTTATAAAA CC#4ADDFHFHHHJIJJIJGIJGIIJJIIJIJIHIIJIIJJJJIJJJJIIEBAHGIIJIIJJJHHHHFFFFEEDD?BDCDCCEDDDDDDDDDDDDDCDCCD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1199:2076_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTNTATTTTTAGAGTGGTTTTTTTGGTATGATTTTTTTGTATTATTATGATATTGTTGTATATTTAGGTTGGAGGAGGTATTTTGGAAAAGAATAGATTGG CC#4ADDFHHGHHHIFHHIJJJJJJJHGJJJJJJJIJJJJJJIIHIIJJIJGIJIJJIIIIFIJJIIJ=DGF?CHEBFCDBEDDDD;<?CA?ACCDDDDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1480:2235_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTATAAATATTATAATTTTATAATAATTAAAATTATTAATTTTATAAATATTATAATTTTATAATAATTATTTTATAAATATTATAATTTTATAATAAT @@BDDEDEFHHHHEHIGHIJJIJJIIJIFGIEAHIIGGGHIGIHGGGEAGIEHG<EGHGEGI@EHGEIGGHGGHF;CBA@ABABDCCACDDDDCCCCCACD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2118_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTATTTATTTTGATTATTTATATTATATGTATTTATAATTATTGTTTTGAATTTTTTGTAATTATAAAATTTGAATTTTAATATATTTTAATTAATTGTTA @@@?BDDDF?FFDF@@GH>HIGGIIIGHF?DD=D9BGGIFB?C1BFHIFA';BBDCCC>9;BB@B<??BBACB(98?CCCCCCCCDCDC>CBC@CCB<>B9 YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1217:2174_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTTTTGTTTTATTTAATTTTTAAAAAAATTTTATTTTTTATTTGTTAAATTATATAATTTTATTTTTTTATTTAAAAAAATATATATTATTTTTATTAG @1?DDDDD<:DFHIIIFH>IHIBHIIDHIEGEGHIIGIGHIGGGGFGG=4=CHHIIID)7-;4;5?DE19;55-;;@C<ABB2:>CCC<<<28A@CC@A>: YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1195:2123_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TGGTTGTAATAAATTGGATTGAGTAAAGAGTTATTGTGGAAATGAGAAATATAAAGTTTGGTGGTAATTAAATATTGTTAGTTTAGTGTGAGAGTGTGAAA CC@FFFFFHHHHHJJHHGIIJIJJJJIIGIGIHHGIGIJGIGGIJGFDGGIJIIIJIJIIJFCH;DHGHHEFFFF?BDDDB@CCEDFDDDDC5@:@>CCAC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1480:2235_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTATAAATATTATAATTTTATAATAATTAAAATTATTAATTTTATAAATATTATAATTTTATAATAATTATTTTATAAATATTATAATTTTATAATAAT @@BDDEDEFHHHHEHIGHIJJIJJIIJIFGIEAHIIGGGHIGIHGGGEAGIEHG<EGHGEGI@EHGEIGGHGGHF;CBA@ABABDCCACDDDDCCCCCACD YT:Z:UU
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:12871:59187_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:12871:59187_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:12871:59187_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1106:12871:59187_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1108:2348:86910_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1108:2348:86910_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1108:2348:86910_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1108:2348:86910_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:21248:32838_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:21248:32838_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:21248:32838_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:21248:32838_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:3158:72782_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:3158:72782_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:3158:72782_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:3158:72782_1:N:0:GCCAAT' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:7707:9858_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:7707:9858_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:7707:9858_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:7707:9858_1:N:0:GCCAAT' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:1511:69890_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:1511:69890_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:1511:69890_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1313:1511:69890_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4372:80646_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4372:80646_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4372:80646_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4372:80646_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:8451:5720_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:8451:5720_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:8451:5720_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:8451:5720_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5871:51074_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5871:51074_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5871:51074_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5871:51074_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5884:32032_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5884:32032_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5884:32032_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2107:5884:32032_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7970:58161_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7970:58161_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7970:58161_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:7970:58161_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:2639:41096_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:2639:41096_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:2639:41096_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:2639:41096_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2209:20955:91417_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2209:20955:91417_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2209:20955:91417_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2209:20955:91417_1:N:0:GCCAAT' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:18359:28225_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:18359:28225_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:18359:28225_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:18359:28225_1:N:0:GCCAAT' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:5317:26651_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:5317:26651_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:5317:26651_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:5317:26651_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:18132:53633_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:18132:53633_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:18132:53633_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:18132:53633_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:2236:66609_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:2236:66609_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:2236:66609_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2309:2236:66609_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19176:11466_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19176:11466_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19176:11466_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19176:11466_1:N:0:GCCAAT' because it was < 2 characters long
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238336 (96.80%) aligned 0 times
35357 (1.53%) aligned exactly 1 time
38670 (1.67%) aligned >1 times
3.20% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2239976 (96.87%) aligned 0 times
34552 (1.49%) aligned exactly 1 time
37835 (1.64%) aligned >1 times
3.13% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58485
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1102761
Total methylated C's in CpG context: 137488
Total methylated C's in CHG context: 168356
Total methylated C's in CHH context: 608076
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26097
Total unmethylated C's in CHG context: 50561
Total unmethylated C's in CHH context: 112183
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.0%
C methylated in CHG context: 76.9%
C methylated in CHH context: 84.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2206877
Sequences did not map uniquely: 47001
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29892 ((converted) top strand)
CT/GA: 28593 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238127 (96.79%) aligned 0 times
35382 (1.53%) aligned exactly 1 time
38854 (1.68%) aligned >1 times
3.21% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2239621 (96.85%) aligned 0 times
34938 (1.51%) aligned exactly 1 time
37804 (1.63%) aligned >1 times
3.15% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58963
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1109895
Total methylated C's in CpG context: 138459
Total methylated C's in CHG context: 169423
Total methylated C's in CHH context: 611128
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26650
Total unmethylated C's in CHG context: 50886
Total unmethylated C's in CHH context: 113349
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.9%
C methylated in CHG context: 76.9%
C methylated in CHH context: 84.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2206484
Sequences did not map uniquely: 46916
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 30181 ((converted) top strand)
CT/GA: 28782 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238339 (96.80%) aligned 0 times
35408 (1.53%) aligned exactly 1 time
38616 (1.67%) aligned >1 times
3.20% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2240430 (96.89%) aligned 0 times
34486 (1.49%) aligned exactly 1 time
37447 (1.62%) aligned >1 times
3.11% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58555
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1100086
Total methylated C's in CpG context: 136447
Total methylated C's in CHG context: 166538
Total methylated C's in CHH context: 605874
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26198
Total unmethylated C's in CHG context: 51321
Total unmethylated C's in CHH context: 113708
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.9%
C methylated in CHG context: 76.4%
C methylated in CHH context: 84.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2207123
Sequences did not map uniquely: 46685
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 30185 ((converted) top strand)
CT/GA: 28370 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2312:1613:47737_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2312:1613:47737_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2312:1613:47737_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2312:1613:47737_1:N:0:GCCAAT' because it was < 2 characters long
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238468 (96.80%) aligned 0 times
34955 (1.51%) aligned exactly 1 time
38940 (1.68%) aligned >1 times
3.20% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2239992 (96.87%) aligned 0 times
34572 (1.50%) aligned exactly 1 time
37799 (1.63%) aligned >1 times
3.13% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58596
Mapping efficiency: 2.5%Sequences with no alignments under any condition: 2206912
Sequences did not map uniquely: 46855
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29906 ((converted) top strand)
CT/GA: 28690 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1103729
Total methylated C's in CpG context: 137626
Total methylated C's in CHG context: 167903
Total methylated C's in CHH context: 608501
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26407
Total unmethylated C's in CHG context: 50348
Total unmethylated C's in CHH context: 112944
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.9%
C methylated in CHG context: 76.9%
C methylated in CHH context: 84.3%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2313:11813:83788_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2313:11813:83788_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2313:11813:83788_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2313:11813:83788_1:N:0:GCCAAT' because it was < 2 characters long
2312362 reads; of these:
2312362 (100.00%) were unpaired; of these:
2240121 (96.88%) aligned 0 times
34668 (1.50%) aligned exactly 1 time
37573 (1.62%) aligned >1 times
3.12% overall alignment rate
2312362 reads; of these:
2312362 (100.00%) were unpaired; of these:
2238455 (96.80%) aligned 0 times
35202 (1.52%) aligned exactly 1 time
38705 (1.67%) aligned >1 times
3.20% overall alignment rateProcessed 2312362 sequences in total2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2240262 (96.88%) aligned 0 times
34553 (1.49%) aligned exactly 1 time
37548 (1.62%) aligned >1 times
3.12% overall alignment rate
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312362
Number of alignments with a unique best hit from the different alignments: 58545
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1100356
Total methylated C's in CpG context: 137215
Total methylated C's in CHG context: 167478
Total methylated C's in CHH context: 605790
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26804
Total unmethylated C's in CHG context: 50601
Total unmethylated C's in CHH context: 112468
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.7%
C methylated in CHG context: 76.8%
C methylated in CHH context: 84.3%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2207034
Sequences did not map uniquely: 46783
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29956 ((converted) top strand)
CT/GA: 28589 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238462 (96.80%) aligned 0 times
35444 (1.53%) aligned exactly 1 time
38457 (1.66%) aligned >1 times
3.20% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58707
Mapping efficiency: 2.5%Sequences with no alignments under any condition: 2207048
Sequences did not map uniquely: 46608
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 30173 ((converted) top strand)
CT/GA: 28534 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1102048
Total methylated C's in CpG context: 136755
Total methylated C's in CHG context: 167230
Total methylated C's in CHH context: 609122
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26262
Total unmethylated C's in CHG context: 49847
Total unmethylated C's in CHH context: 112832
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.9%
C methylated in CHG context: 77.0%
C methylated in CHH context: 84.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2316:20302:14755_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2316:20302:14755_1:N:0:GCCAAT' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2316:20302:14755_1:N:0:GCCAAT' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2316:20302:14755_1:N:0:GCCAAT' because it was < 2 characters long
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238757 (96.82%) aligned 0 times
35042 (1.52%) aligned exactly 1 time
38564 (1.67%) aligned >1 times
3.18% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2240556 (96.89%) aligned 0 times
34415 (1.49%) aligned exactly 1 time
37392 (1.62%) aligned >1 times
3.11% overall alignment rateProcessed 2312363 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58314
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1099668
Total methylated C's in CpG context: 135959
Total methylated C's in CHG context: 166940
Total methylated C's in CHH context: 606039
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26701
Total unmethylated C's in CHG context: 50974
Total unmethylated C's in CHH context: 113055
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.6%
C methylated in CHG context: 76.6%
C methylated in CHH context: 84.3%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2207554
Sequences did not map uniquely: 46495
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29967 ((converted) top strand)
CT/GA: 28347 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2238719 (96.82%) aligned 0 times
34852 (1.51%) aligned exactly 1 time
38792 (1.68%) aligned >1 times
3.18% overall alignment rate
2312363 reads; of these:
2312363 (100.00%) were unpaired; of these:
2240111 (96.88%) aligned 0 times
34611 (1.50%) aligned exactly 1 time
37641 (1.63%) aligned >1 times
3.12% overall alignment rateProcessed 2312363 sequences in total2312362 reads; of these:
2312362 (100.00%) were unpaired; of these:
2238580 (96.81%) aligned 0 times
35092 (1.52%) aligned exactly 1 time
38690 (1.67%) aligned >1 times
3.19% overall alignment rate
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312363
Number of alignments with a unique best hit from the different alignments: 58270
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1094349
Total methylated C's in CpG context: 136114
Total methylated C's in CHG context: 166406
Total methylated C's in CHH context: 605918
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26122
Total unmethylated C's in CHG context: 49763
Total unmethylated C's in CHH context: 110026
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.9%
C methylated in CHG context: 77.0%
C methylated in CHH context: 84.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2207222
Sequences did not map uniquely: 46871
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29663 ((converted) top strand)
CT/GA: 28607 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02312362 reads; of these:
2312362 (100.00%) were unpaired; of these:
2240123 (96.88%) aligned 0 times
34686 (1.50%) aligned exactly 1 time
37553 (1.62%) aligned >1 times
3.12% overall alignment rateProcessed 2312362 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2312362
Number of alignments with a unique best hit from the different alignments: 58576
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1101034
Total methylated C's in CpG context: 135946
Total methylated C's in CHG context: 167081
Total methylated C's in CHH context: 606281
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 26551
Total unmethylated C's in CHG context: 51384
Total unmethylated C's in CHH context: 113791
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.7%
C methylated in CHG context: 76.5%
C methylated in CHH context: 84.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
Right, cleaning up now...
Deleting temporary sequence files...Sequences with no alignments under any condition: 2207117
Sequences did not map uniquely: 46669
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 29907 ((converted) top strand)
CT/GA: 28669 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8 trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_GCCAAT_L001_R1_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_GCCAAT_L001_R1_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 20811265
Number of alignments with a unique best hit from the different alignments: 527011
Mapping efficiency: 2.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 9913926
Total methylated C's in CpG context: 1232009
Total methylated C's in CHG context: 1507355
Total methylated C's in CHH context: 5466729
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 237792
Total unmethylated C's in CHG context: 455685
Total unmethylated C's in CHH context: 1014356
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 83.8%
C methylated in CHG context: 76.8%
C methylated in CHH context: 84.3%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Deleting temporary report files...Sequences with no alignments under any condition: 19863371
Sequences did not map uniquely: 420883
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 269830 ((converted) top strand)
CT/GA: 257181 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_GCCAAT_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'FastQ format specifiedReference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_TGACCA_L001_R1_001.fastq
Files to be analysed:
trimmed-2112_lane1_TGACCA_L001_R1_001.fastq
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 4971 and offset 9
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TGACCA_L001_R1_001.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_TGACCA_L001_R1_001.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6 to trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6 (314123 sequences in total)
Input file is trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2409:2114_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTAGGGTAATGTGTTGTAGGTGTTTGTTAATTTTATTATTATTTTGGAGGATTATATGGAGGAATATTAATGGGTTGTTTTAGGTAGGGGTTATATTAG @@@FFFFDHHHHHCGHHJJIJE?FCHIIJJJIJJJJJJGGIIIJIJIJIEHHHFFFFEEEEDBBBDCDDDDDDDB95>BBDDDDDC@CDBDB5<ACDDDDA YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3609:2233_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTGTTTATTGTTTGTTTATTGTTTGTTTATTGTATGTTTAATGTATGTTTATTGTATTTTTATTGTTTATAATTTTATGTTTAATGTTTATTGTTTGTT @B@DFFFFGHHHHJJEHIIJIHIJJJJJJJJJIHGIJJGIJJGFHIJJJJIHGHHFFFFDEEEEEECB@BCCCDD@CCCC?ACBC>C>AC??C@??@CDD@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3097:2127_1:N:0:TGACCA 4 * 0 0 * * 0 0 TAGGGGAAAAGATAATTAGTATATTTAGTGAGGAGTAAATTATGGAAAAGTTTGGATTTTATGATGTTGAG ?@==D@DFHDFDHIIIBFCEACFBFHII?B?DGIEHHIIEDGGHGGHIEDDF=@@@BA3@=A>EA?7?;(3 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1225:2225_1:N:0:TGACCA 0 MWPT01000292.1_CT_converted 742753 0 62M * 0 0 TTTTGTTGAAAATTGTATGTTTTTGTATTTTGTATAAATTAAAGTTTTTAAGTATAGATTTT ???DD??DD<3C32<:+AC?4C+<1?C18??*1??4:DD>*B*90?D<98*99?C:BC<C@C AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:4A52G4 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3166:2124_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTATTAAATATATTTAATATATAATTTAAAATTTTTTATATATTGTTATTGAAATAATGATGTTTTTTAATATTGATAATTATATAAATATGATATTTA @@@FFFFFFHHHHGIJJIIJIIIEGHIGGGGIEIGGGIJIGIGIBGEHHCEHIDGGCHIJIEEBCCBDDDDDDDFCDDDDDDDDDDDDDDDDDDDDDDEED YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2332:2223_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGATGGAGGAGAGTTATGTTTTTTTTTTTTTTTTTTGGTTAGTTATATATATGTTTAAGAGAAAGGGGTTGGATTTTTTAATGGTTAGGAAGTATGGG CCC?DFFFHHHHHGIJJJJJJJJJIJJFJJEGICG@AE=>DEGHHEHHFFEDEEEECCCAC?CDDDDB2;BB55>4@CC@AC@CBDCDB<<<::@BDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1110:2171_1:N:0:TGACCA 4 * 0 0 * * 0 0 TGTGTGTTTGTTATTGTTTGATGTATAGATATTTTTATTGATGTTTTTTGTGATGTTGTGTGATT CCCFFFDDHHHHFHIIIHIJEHIIDIGHGIII?CBDDGHIGGGIJIJFHIIIFHFBFHDHHIGED YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1818:2247_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGTGTAGAGTAGTGTAGTGTAGTGTAGTGTAGTTAAGTGTATAGTAGTGTTGTTAAGTGTAGAGGAGTGTAGTG @@@BDDDDHAAD<A,2C?FE>ECFC:FACEHFCB<<C<B199:E94CD@:CBGCA4??D999*B(9?888/=)= YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2975:2083_1:N:0:TGACCA 4 * 0 0 * * 0 0 GATTTGTTGTTATAGGTTGTGTTGTTAAAATGTTGGTTATAGTAATTTTTTTTAGTTTTAATTTTATTTTTTTTTTTGTGTTTTGTTTTAATATTTGGTTG @@@DDDB:FDFHHIIGAGFEHIEGGHGIGFIGFFHFHGGHEAHFCAHHEEEE@DE@BCCCCCCCCCDCCCECCCC>CBCBBBBBCCCCCCCEACDEECCC@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2409:2114_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTAGGGTAATGTGTTGTAGGTGTTTGTTAATTTTATTATTATTTTGGAGGATTATATGGAGGAATATTAATGGGTTGTTTTAGGTAGGGGTTATATTAG @@@FFFFDHHHHHCGHHJJIJE?FCHIIJJJIJJJJJJGGIIIJIJIJIEHHHFFFFEEEEDBBBDCDDDDDDDB95>BBDDDDDC@CDBDB5<ACDDDDA YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3609:2233_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTGTTTATTGTTTGTTTATTGTTTGTTTATTGTATGTTTAATGTATGTTTATTGTATTTTTATTGTTTATAATTTTATGTTTAATGTTTATTGTTTGTT @B@DFFFFGHHHHJJEHIIJIHIJJJJJJJJJIHGIJJGIJJGFHIJJJJIHGHHFFFFDEEEEEECB@BCCCDD@CCCC?ACBC>C>AC??C@??@CDD@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3097:2127_1:N:0:TGACCA 16 MWPT01000140.1_GA_converted 207271 0 71M * 0 0 CTCAACATCATAAAATCCAAACTTTTCCATAATTTACTCCTCACTAAATATACTAATTATCTTTTCCCCTA 3(;?7?AE>A=@3AB@@@=FDDEIHGGHGGDEIIHHEIGD?B?IIHFBFCAECFBIIIHDFDHFD@D==@? AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:33C28C8 YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1225:2225_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTGTTGAAAATTGTATGTTTTTGTATTTTGTATAAATTAAAGTTTTTAAGTATAGATTTT ???DD??DD<3C32<:+AC?4C+<1?C18??*1??4:DD>*B*90?D<98*99?C:BC<C@C YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3166:2124_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTATTAAATATATTTAATATATAATTTAAAATTTTTTATATATTGTTATTGAAATAATGATGTTTTTTAATATTGATAATTATATAAATATGATATTTA @@@FFFFFFHHHHGIJJIIJIIIEGHIGGGGIEIGGGIJIGIGIBGEHHCEHIDGGCHIJIEEBCCBDDDDDDDFCDDDDDDDDDDDDDDDDDDDDDDEED YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1110:2171_1:N:0:TGACCA 4 * 0 0 * * 0 0 TGTGTGTTTGTTATTGTTTGATGTATAGATATTTTTATTGATGTTTTTTGTGATGTTGTGTGATT CCCFFFDDHHHHFHIIIHIJEHIIDIGHGIII?CBDDGHIGGGIJIJFHIIIFHFBFHDHHIGED YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2332:2223_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGATGGAGGAGAGTTATGTTTTTTTTTTTTTTTTTTGGTTAGTTATATATATGTTTAAGAGAAAGGGGTTGGATTTTTTAATGGTTAGGAAGTATGGG CCC?DFFFHHHHHGIJJJJJJJJJIJJFJJEGICG@AE=>DEGHHEHHFFEDEEEECCCAC?CDDDDB2;BB55>4@CC@AC@CBDCDB<<<::@BDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1818:2247_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGTGTAGAGTAGTGTAGTGTAGTGTAGTGTAGTTAAGTGTATAGTAGTGTTGTTAAGTGTAGAGGAGTGTAGTG @@@BDDDDHAAD<A,2C?FE>ECFC:FACEHFCB<<C<B199:E94CD@:CBGCA4??D999*B(9?888/=)= YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2975:2083_1:N:0:TGACCA 4 * 0 0 * * 0 0 GATTTGTTGTTATAGGTTGTGTTGTTAAAATGTTGGTTATAGTAATTTTTTTTAGTTTTAATTTTATTTTTTTTTTTGTGTTTTGTTTTAATATTTGGTTG @@@DDDB:FDFHHIIGAGFEHIEGGHGIGFIGFFHFHGGHEAHFCAHHEEEE@DE@BCCCCCCCCCDCCCECCCC>CBCBBBBBCCCCCCCEACDEECCC@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3
Reading in the sequence file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:11781:61610_1:N:0:TGACCA' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:11781:61610_1:N:0:TGACCA' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:11781:61610_1:N:0:TGACCA' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:11781:61610_1:N:0:TGACCA' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:18088:99876_1:N:0:TGACCA' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:18088:99876_1:N:0:TGACCA' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:18088:99876_1:N:0:TGACCA' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2110:18088:99876_1:N:0:TGACCA' because it was < 2 characters long
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280589 (89.32%) aligned 0 times
18069 (5.75%) aligned exactly 1 time
15465 (4.92%) aligned >1 times
10.68% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
281051 (89.47%) aligned 0 times
17681 (5.63%) aligned exactly 1 time
15391 (4.90%) aligned >1 times
10.53% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30206
Mapping efficiency: 9.6%Sequences with no alignments under any condition: 264164
Sequences did not map uniquely: 19753
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15488 ((converted) top strand)
CT/GA: 14718 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 625841
Total methylated C's in CpG context: 121675
Total methylated C's in CHG context: 118837
Total methylated C's in CHH context: 304367
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8562
Total unmethylated C's in CHG context: 33479
Total unmethylated C's in CHH context: 38921
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.4%
C methylated in CHG context: 78.0%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280117 (89.17%) aligned 0 times
18237 (5.81%) aligned exactly 1 time
15769 (5.02%) aligned >1 times
10.83% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280607 (89.33%) aligned 0 times
17904 (5.70%) aligned exactly 1 time
15612 (4.97%) aligned >1 times
10.67% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30460
Mapping efficiency: 9.7%Sequences with no alignments under any condition: 263567
Sequences did not map uniquely: 20096
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15579 ((converted) top strand)
CT/GA: 14881 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 630776
Total methylated C's in CpG context: 122512
Total methylated C's in CHG context: 120386
Total methylated C's in CHH context: 305389
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8569
Total unmethylated C's in CHG context: 33952
Total unmethylated C's in CHH context: 39968
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.5%
C methylated in CHG context: 78.0%
C methylated in CHH context: 88.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280487 (89.29%) aligned 0 times
18114 (5.77%) aligned exactly 1 time
15522 (4.94%) aligned >1 times
10.71% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280978 (89.45%) aligned 0 times
17780 (5.66%) aligned exactly 1 time
15365 (4.89%) aligned >1 times
10.55% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30377
Mapping efficiency: 9.7%Sequences with no alignments under any condition: 264002
Sequences did not map uniquely: 19744
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15596 ((converted) top strand)
CT/GA: 14781 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 631286
Total methylated C's in CpG context: 123473
Total methylated C's in CHG context: 120374
Total methylated C's in CHH context: 307090
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8220
Total unmethylated C's in CHG context: 33206
Total unmethylated C's in CHH context: 38923
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.8%
C methylated in CHG context: 78.4%
C methylated in CHH context: 88.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280698 (89.36%) aligned 0 times
17908 (5.70%) aligned exactly 1 time
15517 (4.94%) aligned >1 times
10.64% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280841 (89.40%) aligned 0 times
17727 (5.64%) aligned exactly 1 time
15555 (4.95%) aligned >1 times
10.60% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30116
Mapping efficiency: 9.6%Sequences with no alignments under any condition: 264148
Sequences did not map uniquely: 19859
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15323 ((converted) top strand)
CT/GA: 14793 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 625509
Total methylated C's in CpG context: 123009
Total methylated C's in CHG context: 119040
Total methylated C's in CHH context: 303256
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8287
Total unmethylated C's in CHG context: 33223
Total unmethylated C's in CHH context: 38694
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.7%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280085 (89.16%) aligned 0 times
18391 (5.85%) aligned exactly 1 time
15647 (4.98%) aligned >1 times
10.84% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
281202 (89.52%) aligned 0 times
17615 (5.61%) aligned exactly 1 time
15306 (4.87%) aligned >1 times
10.48% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30696
Mapping efficiency: 9.8%Sequences with no alignments under any condition: 263754
Sequences did not map uniquely: 19673
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15959 ((converted) top strand)
CT/GA: 14737 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 638097
Total methylated C's in CpG context: 124990
Total methylated C's in CHG context: 121887
Total methylated C's in CHH context: 310310
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8364
Total unmethylated C's in CHG context: 33370
Total unmethylated C's in CHH context: 39176
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.7%
C methylated in CHG context: 78.5%
C methylated in CHH context: 88.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280727 (89.37%) aligned 0 times
17934 (5.71%) aligned exactly 1 time
15462 (4.92%) aligned >1 times
10.63% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
281050 (89.47%) aligned 0 times
17799 (5.67%) aligned exactly 1 time
15274 (4.86%) aligned >1 times
10.53% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30337
Mapping efficiency: 9.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 630433
Total methylated C's in CpG context: 123438
Total methylated C's in CHG context: 120658
Total methylated C's in CHH context: 306089
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8456
Total unmethylated C's in CHG context: 33350
Total unmethylated C's in CHH context: 38442
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.3%
C methylated in CHH context: 88.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 264186
Sequences did not map uniquely: 19600
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15446 ((converted) top strand)
CT/GA: 14891 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280531 (89.31%) aligned 0 times
18032 (5.74%) aligned exactly 1 time
15560 (4.95%) aligned >1 times
10.69% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280897 (89.42%) aligned 0 times
17773 (5.66%) aligned exactly 1 time
15453 (4.92%) aligned >1 times
10.58% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30357
Mapping efficiency: 9.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 630402
Total methylated C's in CpG context: 123657
Total methylated C's in CHG context: 119944
Total methylated C's in CHH context: 306381
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8046
Total unmethylated C's in CHG context: 33118
Total unmethylated C's in CHH context: 39256
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.9%
C methylated in CHG context: 78.4%
C methylated in CHH context: 88.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to completeSequences with no alignments under any condition: 263955
Sequences did not map uniquely: 19811
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15458 ((converted) top strand)
CT/GA: 14899 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280304 (89.23%) aligned 0 times
18280 (5.82%) aligned exactly 1 time
15539 (4.95%) aligned >1 times
10.77% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280740 (89.37%) aligned 0 times
17976 (5.72%) aligned exactly 1 time
15407 (4.90%) aligned >1 times
10.63% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30710
Mapping efficiency: 9.8%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 637050
Total methylated C's in CpG context: 124649
Total methylated C's in CHG context: 121068
Total methylated C's in CHH context: 309995
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8549
Total unmethylated C's in CHG context: 33450
Total unmethylated C's in CHH context: 39339
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.4%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 263651
Sequences did not map uniquely: 19762
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15661 ((converted) top strand)
CT/GA: 15049 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280626 (89.34%) aligned 0 times
18026 (5.74%) aligned exactly 1 time
15471 (4.93%) aligned >1 times
10.66% overall alignment rate
314123 reads; of these:
314123 (100.00%) were unpaired; of these:
280742 (89.37%) aligned 0 times
18084 (5.76%) aligned exactly 1 time
15297 (4.87%) aligned >1 times
10.63% overall alignment rateProcessed 314123 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 314123
Number of alignments with a unique best hit from the different alignments: 30438
Mapping efficiency: 9.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 631423
Total methylated C's in CpG context: 123965
Total methylated C's in CHG context: 119918
Total methylated C's in CHH context: 306902
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 8347
Total unmethylated C's in CHG context: 33384
Total unmethylated C's in CHH context: 38907
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.7%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 263883
Sequences did not map uniquely: 19802
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 15394 ((converted) top strand)
CT/GA: 15044 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8 trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_TGACCA_L001_R1_001_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TGACCA_L001_R1_001_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 2827107
Number of alignments with a unique best hit from the different alignments: 273697
Mapping efficiency: 9.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5680817
Total methylated C's in CpG context: 1111368
Total methylated C's in CHG context: 1082112
Total methylated C's in CHH context: 2759779
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 75400
Total unmethylated C's in CHG context: 300532
Total unmethylated C's in CHH context: 351626
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.3%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Deleting temporary report files...Sequences with no alignments under any condition: 2375310
Sequences did not map uniquely: 178100
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139904 ((converted) top strand)
CT/GA: 133793 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_TGACCA_L001_R1_001.fastq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: trimmed-2112_lane1_TTAGGC_L001_R1.fastq
Files to be analysed:
trimmed-2112_lane1_TTAGGC_L001_R1.fastqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 4
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 8
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 1
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 6343 and offset 9
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 2
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 7
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 3
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 5
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_C_to_T.fastq
Finished subdividing trimmed-2112_lane1_TTAGGC_L001_R1.fastq for PID: 0 and offset 6
Using the subset file >trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6< as new in-file (instead of >trimmed-2112_lane1_TTAGGC_L001_R1.fastq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6 to trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_C_to_T.fastq
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1192:2181_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATATTAAAATTATTTTAATAAAAAATATTTGTTTTATAATAATTATTTTTTTAAATTTATAATATTTATATTAATTATAAAATGTTTAATAATAAAATT ??@+=BDDF?FAAE<E,CHHFC@GEEGFIE>A:D*?D@FE@?909DBB*??<BC)=F@@FICCEEE;C=EED;BB6;ABCCABBB(999:@A:@A@55:@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1427:2107_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAATAAAATATTGGTATATATTAAAAAATTTTAAATATTAAATAAATTTT =@=AD?1<CDFFF<FGEBH4FH<A3C?@F86B9D9DGFFIIFIB7=FFI>EC5CFE>AB7@;?? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1192:2181_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATATTAAAATTATTTTAATAAAAAATATTTGTTTTATAATAATTATTTTTTTAAATTTATAATATTTATATTAATTATAAAATGTTTAATAATAAAATT ??@+=BDDF?FAAE<E,CHHFC@GEEGFIE>A:D*?D@FE@?909DBB*??<BC)=F@@FICCEEE;C=EED;BB6;ABCCABBB(999:@A:@A@55:@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2.bam <<<
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1427:2107_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAATAAAATATTGGTATATATTAAAAAATTTTAAATATTAAATAAATTTT =@=AD?1<CDFFF<FGEBH4FH<A3C?@F86B9D9DGFFIIFIB7=FFI>EC5CFE>AB7@;?? YT:Z:UU
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2.bam <<<
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2211_1:N:0:TTAGGC 4 * 0 0 * * 0 0 ATTATTATAAATTAATTATTTTTATAATAATTTTTTTAATATTTTTTATTTAAAATTTTTAAAATTAAAAAAATTAATAAATTTTATTTTTATAATTTATA ?@BDFFFFFHGHHJAHIFHJIJIHHHIIJIJJJJJJGGIIEIIIJJJIJIJCGGBDDHIJGGHIEHIDFHIE>@CCACCCCCCDDDDDDDDDDCCCDDCD: YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1378:2089_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATGTTGTATATTATATTTTTGTGATAATATTATTGTAATTATAAAAAAAAATTATAATATATTTATATAAATTTTTGATTATAATTGTTGAAATAAAAAA CCCFFFFDHHHHHJJJJJJJJJJJIIJJJGIGJIIJHIGIJJJIJJJJJHFDCCCDDDDDDDEDEFDDDDDBBBC<ABDBDDDDDDDDBBDBBDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1285:2160_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAAATGAATTATTTTGATTAATTGTTGTTTTATAAAAAAAAAATGAAAATTTATGATTTTATTAAATATTTATATTAATTATTATTA CCCFFFFFHHHHHJJJJJJJJJJJJIIHIJJJJJIJJIGJHIJJHHFEEEDCBDDDDDB<?@BCBB?B@5>BDC32>CCDDABCDDDDEEEEDDCCDDED: YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2211_1:N:0:TTAGGC 4 * 0 0 * * 0 0 ATTATTATAAATTAATTATTTTTATAATAATTTTTTTAATATTTTTTATTTAAAATTTTTAAAATTAAAAAAATTAATAAATTTTATTTTTATAATTTATA ?@BDFFFFFHGHHJAHIFHJIJIHHHIIJIJJJJJJGGIIEIIIJJJIJIJCGGBDDHIJGGHIEHIDFHIE>@CCACCCCCCDDDDDDDDDDCCCDDCD: YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1394:2182_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTATTTTTTATATAATTAATTTAATTTTAATTTTAATATTTAAATTTTAATTAGTAATTATAATATTAATATTATTATATAAATAAATATTATTAATTA @?@4BDEFHHHHHJJJJIJJJIIJJIJJJJJJIIJJJJJIIJJJJIJJJJJJJJJJJJGGJIJJJJHHHHHGFFFBDEDEEEEEEDDBDDDDDDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1365:2176_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTGATTTTTTTAATTTAAAATTATAAATTAAAATTTTAAATAAATTTGAATTTAATGAAATTAATAATGAAATTTTTAAAAAATTTATTATTTTAATTGA @@@FFFFAHHGHFIJJIEIFIIIJIGHIIIJIHIGIJJJIJIGGIJJJJAGHJJJGHHD@FIIIIGHICAEEFFF;@DEDEABDDACDDDEEDDECCDBD< YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3 (2384760 sequences in total)
Input file is trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1378:2089_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATGTTGTATATTATATTTTTGTGATAATATTATTGTAATTATAAAAAAAAATTATAATATATTTATATAAATTTTTGATTATAATTGTTGAAATAAAAAA CCCFFFFDHHHHHJJJJJJJJJJJIIJJJGIGJIIJHIGIJJJIJJJJJHFDCCCDDDDDDDEDEFDDDDDBBBC<ABDBDDDDDDDDBBDBBDDDDDDDD YT:Z:UU
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1420:2130_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTATTTTTATTATAATAATAAATATTTTTTATATTAAAAAATATAAAAAAAAAATAAATTTTTATATAAAATATATATATATAAAATATTTAAAATATTA @CCFFFFFHAHHHJJJIIIJGIIIJJJJJJJJJJIJJGEIJJJJIIJJJJJIHFDDEDDDDBDC>:>>CDDDC982<80258<@B<A>ACCDDCD?ACADC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1365:2176_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTGATTTTTTTAATTTAAAATTATAAATTAAAATTTTAAATAAATTTGAATTTAATGAAATTAATAATGAAATTTTTAAAAAATTTATTATTTTAATTGA @@@FFFFAHHGHFIJJIEIFIIIJIGHIIIJIHIGIJJJIJIGGIJJJJAGHJJJGHHD@FIIIIGHICAEEFFF;@DEDEABDDACDDDEEDDECCDBD< YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1158:2233_1:N:0:TTAGGC 4 * 0 0 * * 0 0 AATGGGTAATATTTTAAAAAATAAAATGTTAATTTTAATTTAAAAAAATTTAATTTATTATTTAATATTAATTTTAATTTAAAAAAATTTAATTTTATTAT CCCFFFFF?>FHFJIIHGIIJGIHEDH??FHIJJJHGIIIHGB<FBH8BEH?DFDE@CCDCDCCDDCCCDCDDCDCDDDC@>CCDDDBBDDDDDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1394:2182_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTATTTTTTATATAATTAATTTAATTTTAATTTTAATATTTAAATTTTAATTAGTAATTATAATATTAATATTATTATATAAATAAATATTATTAATTA @?@4BDEFHHHHHJJJJIJJJIIJJIJJJJJJIIJJJJJIIJJJJIJJJJJJJJJJJJGGJIJJJJHHHHHGFFFBDEDEEEEEEDDBDDDDDDDDDDDDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1285:2160_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAAATGAATTATTTTGATTAATTGTTGTTTTATAAAAAAAAAATGAAAATTTATGATTTTATTAAATATTTATATTAATTATTATTA CCCFFFFFHHHHHJJJJJJJJJJJJIIHIJJJJJIJJIGJHIJJHHFEEEDCBDDDDDB<?@BCBB?B@5>BDC32>CCDDABCDDDDEEEEDDCCDDED: YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1420:2130_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTATTTTTATTATAATAATAAATATTTTTTATATTAAAAAATATAAAAAAAAAATAAATTTTTATATAAAATATATATATATAAAATATTTAAAATATTA @CCFFFFFHAHHHJJJIIIJGIIIJJJJJJJJJJIJJGEIJJJJIIJJJJJIHFDDEDDDDBDC>:>>CDDDC982<80258<@B<A>ACCDDCD?ACADC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1158:2233_1:N:0:TTAGGC 4 * 0 0 * * 0 0 AATGGGTAATATTTTAAAAAATAAAATGTTAATTTTAATTTAAAAAAATTTAATTTATTATTTAATATTAATTTTAATTTAAAAAAATTTAATTTTATTAT CCCFFFFF?>FHFJIIHGIIJGIHEDH??FHIJJJHGIIIHGB<FBH8BEH?DFDE@CCDCDCCDDCCCDCDDCDCDDDC@>CCDDDBBDDDDDDDDDDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2.bam <<<
Reading in the sequence file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1105:20284:71435_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1105:20284:71435_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1105:20284:71435_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1105:20284:71435_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:7863:45399_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:7863:45399_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:7863:45399_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1109:7863:45399_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:20812:68720_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:20812:68720_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:20812:68720_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1110:20812:68720_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:5227:24037_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:5227:24037_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:5227:24037_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1111:5227:24037_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1201:9020:28482_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1201:9020:28482_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1201:9020:28482_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1201:9020:28482_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1765:7763_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1765:7763_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1765:7763_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1208:1765:7763_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1301:9827:92122_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1301:9827:92122_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1301:9827:92122_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1301:9827:92122_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1216:3752:29619_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1216:3752:29619_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1216:3752:29619_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1216:3752:29619_1:N:0:TTAGGC' because it was < 2 characters long
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:11458:97070_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:11458:97070_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:11458:97070_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:1314:11458:97070_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2104:18319:21436_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2104:18319:21436_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2104:18319:21436_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2104:18319:21436_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4988:67942_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4988:67942_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4988:67942_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2105:4988:67942_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:1887:7429_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:1887:7429_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:1887:7429_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2115:1887:7429_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2301:21274:80179_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2301:21274:80179_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2301:21274:80179_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2301:21274:80179_1:N:0:TTAGGC' because it was < 2 characters long
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2210:3775:42371_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2210:3775:42371_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2210:3775:42371_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2210:3775:42371_1:N:0:TTAGGC' because it was < 2 characters long
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:1349:17177_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:1349:17177_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:1349:17177_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2213:1349:17177_1:N:0:TTAGGC' because it was < 2 characters long
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:2051:79531_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:2051:79531_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:2051:79531_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2308:2051:79531_1:N:0:TTAGGC' because it was < 2 characters long
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:15573:93548_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:15573:93548_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:15573:93548_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2311:15573:93548_1:N:0:TTAGGC' because it was < 2 characters long
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269555 (95.17%) aligned 0 times
59029 (2.48%) aligned exactly 1 time
56176 (2.36%) aligned >1 times
4.83% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2268136 (95.11%) aligned 0 times
59307 (2.49%) aligned exactly 1 time
57317 (2.40%) aligned >1 times
4.89% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100435
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1988189
Total methylated C's in CpG context: 291618
Total methylated C's in CHG context: 264138
Total methylated C's in CHH context: 843650
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 53247
Total unmethylated C's in CHG context: 185091
Total unmethylated C's in CHH context: 350445
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.6%
C methylated in CHG context: 58.8%
C methylated in CHH context: 70.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2215173
Sequences did not map uniquely: 69152
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51174 ((converted) top strand)
CT/GA: 49261 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267471 (95.08%) aligned 0 times
59741 (2.51%) aligned exactly 1 time
57548 (2.41%) aligned >1 times
4.92% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269529 (95.17%) aligned 0 times
58838 (2.47%) aligned exactly 1 time
56393 (2.36%) aligned >1 times
4.83% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100553
Mapping efficiency: 4.2%Sequences with no alignments under any condition: 2214669
Sequences did not map uniquely: 69538
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51554 ((converted) top strand)
CT/GA: 48999 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1989286
Total methylated C's in CpG context: 291382
Total methylated C's in CHG context: 264083
Total methylated C's in CHH context: 843910
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 54252
Total unmethylated C's in CHG context: 184415
Total unmethylated C's in CHH context: 351244
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 58.9%
C methylated in CHH context: 70.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19602:28141_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19602:28141_1:N:0:TTAGGC' because it was < 2 characters long
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19602:28141_1:N:0:TTAGGC' because length (1) <= # seed mismatches (1)
Warning: skipping read 'HWI-ST0747:461:C64YUACXX:1:2310:19602:28141_1:N:0:TTAGGC' because it was < 2 characters long
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2268669 (95.13%) aligned 0 times
59026 (2.48%) aligned exactly 1 time
57065 (2.39%) aligned >1 times
4.87% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2270002 (95.19%) aligned 0 times
58801 (2.47%) aligned exactly 1 time
55957 (2.35%) aligned >1 times
4.81% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100414
Mapping efficiency: 4.2%Sequences with no alignments under any condition: 2215511
Sequences did not map uniquely: 68835
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51149 ((converted) top strand)
CT/GA: 49265 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1984701
Total methylated C's in CpG context: 289852
Total methylated C's in CHG context: 263732
Total methylated C's in CHH context: 842189
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 54015
Total unmethylated C's in CHG context: 184431
Total unmethylated C's in CHH context: 350482
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 58.8%
C methylated in CHH context: 70.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267957 (95.10%) aligned 0 times
59504 (2.50%) aligned exactly 1 time
57299 (2.40%) aligned >1 times
4.90% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269809 (95.18%) aligned 0 times
58772 (2.46%) aligned exactly 1 time
56179 (2.36%) aligned >1 times
4.82% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100146
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1981990
Total methylated C's in CpG context: 289300
Total methylated C's in CHG context: 264232
Total methylated C's in CHH context: 841997
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 53268
Total unmethylated C's in CHG context: 183540
Total unmethylated C's in CHH context: 349653
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 59.0%
C methylated in CHH context: 70.7%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 2215274
Sequences did not map uniquely: 69340
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51326 ((converted) top strand)
CT/GA: 48820 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267697 (95.09%) aligned 0 times
59496 (2.49%) aligned exactly 1 time
57567 (2.41%) aligned >1 times
4.91% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269915 (95.18%) aligned 0 times
58447 (2.45%) aligned exactly 1 time
56398 (2.36%) aligned >1 times
4.82% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 99987
Mapping efficiency: 4.2%Sequences with no alignments under any condition: 2215278
Sequences did not map uniquely: 69495
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51319 ((converted) top strand)
CT/GA: 48668 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1983155
Total methylated C's in CpG context: 289486
Total methylated C's in CHG context: 263756
Total methylated C's in CHH context: 839752
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 53997
Total unmethylated C's in CHG context: 184711
Total unmethylated C's in CHH context: 351453
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 58.8%
C methylated in CHH context: 70.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267569 (95.09%) aligned 0 times
59900 (2.51%) aligned exactly 1 time
57291 (2.40%) aligned >1 times
4.91% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269548 (95.17%) aligned 0 times
58921 (2.47%) aligned exactly 1 time
56291 (2.36%) aligned >1 times
4.83% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100657
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1993097
Total methylated C's in CpG context: 291613
Total methylated C's in CHG context: 266130
Total methylated C's in CHH context: 846705
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 53641
Total unmethylated C's in CHG context: 184573
Total unmethylated C's in CHH context: 350435
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 59.0%
C methylated in CHH context: 70.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2214734
Sequences did not map uniquely: 69369
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51530 ((converted) top strand)
CT/GA: 49127 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267669 (95.09%) aligned 0 times
59477 (2.49%) aligned exactly 1 time
57614 (2.42%) aligned >1 times
4.91% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269306 (95.16%) aligned 0 times
59114 (2.48%) aligned exactly 1 time
56340 (2.36%) aligned >1 times
4.84% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100609
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1992810
Total methylated C's in CpG context: 291392
Total methylated C's in CHG context: 265395
Total methylated C's in CHH context: 847788
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 53436
Total unmethylated C's in CHG context: 184276
Total unmethylated C's in CHH context: 350523
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 59.0%
C methylated in CHH context: 70.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2214492
Sequences did not map uniquely: 69659
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51352 ((converted) top strand)
CT/GA: 49257 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267986 (95.10%) aligned 0 times
59712 (2.50%) aligned exactly 1 time
57062 (2.39%) aligned >1 times
4.90% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269733 (95.18%) aligned 0 times
59042 (2.48%) aligned exactly 1 time
55985 (2.35%) aligned >1 times
4.82% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100680
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1992950
Total methylated C's in CpG context: 290818
Total methylated C's in CHG context: 265441
Total methylated C's in CHH context: 847054
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 53768
Total unmethylated C's in CHG context: 184594
Total unmethylated C's in CHH context: 351275
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.4%
C methylated in CHG context: 59.0%
C methylated in CHH context: 70.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2214949
Sequences did not map uniquely: 69131
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51392 ((converted) top strand)
CT/GA: 49288 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2267421 (95.08%) aligned 0 times
59745 (2.51%) aligned exactly 1 time
57594 (2.42%) aligned >1 times
4.92% overall alignment rate
2384760 reads; of these:
2384760 (100.00%) were unpaired; of these:
2269161 (95.15%) aligned 0 times
58932 (2.47%) aligned exactly 1 time
56667 (2.38%) aligned >1 times
4.85% overall alignment rateProcessed 2384760 sequences in total
Successfully deleted the temporary file trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2384760
Number of alignments with a unique best hit from the different alignments: 100650
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1991390
Total methylated C's in CpG context: 290613
Total methylated C's in CHG context: 264403
Total methylated C's in CHH context: 843596
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 54575
Total unmethylated C's in CHG context: 185906
Total unmethylated C's in CHH context: 352297
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.2%
C methylated in CHG context: 58.7%
C methylated in CHH context: 70.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2214370
Sequences did not map uniquely: 69740
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51479 ((converted) top strand)
CT/GA: 49171 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
Right, cleaning up now...
Deleting temporary sequence files...trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8 trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9 Now merging BAM files trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2.bam trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2.bam into >>> trimmed-2112_lane1_TTAGGC_L001_R1_bismark_bt2.bam <<<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2.bam <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1_bismark_bt2_SE_report.txt
Now merging temporary reports trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/trimmed-2112_lane/trimmed-2112_lane1_TTAGGC_L001_R1_bismark_bt2_SE_report.txt <<<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 21462840
Number of alignments with a unique best hit from the different alignments: 904131
Mapping efficiency: 4.2%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 17897568
Total methylated C's in CpG context: 2616074
Total methylated C's in CHG context: 2381310
Total methylated C's in CHH context: 7596641
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 484199
Total unmethylated C's in CHG context: 1661537
Total unmethylated C's in CHH context: 3157807
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.4%
C methylated in CHG context: 58.9%
C methylated in CHH context: 70.6%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...Sequences with no alignments under any condition: 19934450
Sequences did not map uniquely: 624259
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 462275 ((converted) top strand)
CT/GA: 441856 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.1_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.2_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.3_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.4_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.5_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.6_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.7_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.8_bismark_bt2_SE_report.txt trimmed-2112_lane1_TTAGGC_L001_R1.fastq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================