KPAI HPV Reference Hubv3.0

Keletso Phohlo · KP Analytics Insights (PTY) Ltd

ORCID: 0000-0002-9413-5672 | kpinsights@proton.me

🧬

KPAI HPV Reference Hub v3.0

KP Analytics Insights · Papillomaviridae Resource Hub

Taxonomy Update: Papillomaviridae was separated from Polyomaviridae (former Papovaviridae) by ICTV in 2000–2005. The family now has two sub-families: Firstpapillomavirinae (contains Alpha, Beta, Gamma, Mu, Nu, Delta, and other genera) and Secondpapillomavirinae (contains only Dyodeltapapillomavirus, infecting reptiles).

Navigate the Reference Center

Taxonomy

Hierarchical classification from Family → Genus → Species → Type → Variant

Genera & Lineages

Complete ICTV taxonomy: 5 genera, 49 species, genotypes, lineages & sub-lineages

HPV Evolution

Co-speciation, migration patterns, phylogeography

Genome & Genes

Detailed E1–E7, L1–L2 gene functions

Pathology

IARC classification, CIN grading, E6/E7 mechanisms

Vaccines & Therapeutics

Gardasil 9, Cervarix, global programs, therapeutic targets

Immune Response

Innate & adaptive immunity, evasion strategies, immunotherapy

Carcinogenesis

Molecular & genetic basis of HPV-driven cancer

Cell Entry & Infection

HSPG binding, endocytosis, nuclear delivery, keratinocyte biology

Assays & Primers

Validated assays + PCR primer sequences

HPV DNA/RNA Assays

Validated platforms, IARC 100B alignment, emerging diagnostics

HPV Interactome

Infection patterns, co-detection pairs & network science

HPV & Co-infections

BV, STIs, vaginal microbiome & co-infection biology

HPV Conferences

IPVC, EUROGIN 2021–2026

Researcher Profile

KP Analytics Insights - interactive publications & profiles

Research Blog

Share your network plots & findings

HPV Databases

PaVE, PapillomaBase, PVdb - key online resources

Bibliography

Complete reference list (Vancouver format)

Core References

de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H. (2004). Classification of papillomaviruses. Virology 324(1):17–27. [118 PV types, 16 genera - foundational classification]

IARC Monographs Vol.100B (2012). Biological Agents. International Agency for Research on Cancer, Lyon. [Group 1/2A/2B HR-HPV classification]

Muñoz N, Bosch FX, de Sanjosé S et al. (2003). Epidemiological classification of HPV types associated with cervical cancer. N Engl J Med 348:518–527.

Bernard HU, Burk RD, Chen Z et al. (2010). Classification and nomenclature of papillomaviruses. Virology 401(1):70–79.

ICTV Report: Papillomaviridae (ictv.global). Current authoritative taxonomy; includes reports for all genera.

Cite This Resource

DOI: 10.5281/zenodo.19221393

If you use this resource in your research, please cite: Phohlo K. (2026). KPAI HPV Reference Hub v3.0: A Comprehensive Interactive Papillomaviridae Classification and Diagnostic Reference Hub. KP Analytics Insights (PTY) Ltd. Zenodo. https://doi.org/10.5281/zenodo.19221393

BibTeX

@software{phohlo2026hpvhub,
  author    = {Phohlo, Keletso},
  title     = {{KPAI HPV Reference Hub v3.0}},
  year      = {2026},
  publisher = {Zenodo},
  version   = {3.0},
  doi       = {10.5281/zenodo.19221393},
  url       = {https://doi.org/10.5281/zenodo.19221393},
  orcid     = {0000-0002-9413-5672}
}

Genome-Based Taxonomic Framework

Hierarchical classification based on L1 ORF nucleotide sequence identity comparisons.

Taxonomic basis (de Villiers et al., 2004): PV type classification uses L1 ORF nucleotide sequence comparison. >10% divergence = new type; 2-10% = subtype; <2% = variant. A new type must have the complete genome cloned and deposited at the HPV Reference Center, Heidelberg. The ICTV formally separated Papillomaviridae from Polyomaviridae in 2005.

Family Sub-division (ICTV 2005): Firstpapillomavirinae - contains genera Alpha, Beta, Gamma, Delta, Epsilon, Zeta, Eta, Theta, Iota, Kappa, Lambda, Mu, Nu, Xi and others. Secondpapillomavirinae - contains only Dyodeltapapillomavirus (reptile-infecting). Previously classified under Papovaviridae.

Taxonomic Hierarchy

ORDER

↓

Unassigned

FAMILY

↓

Papillomaviridae

SUB-FAMILY

↓

Firstpapillomavirinae

Secondpapillomavirinae

GENUS

↓

Alpha

Beta

Gamma

Delta

Epsilon

Zeta

Eta

Theta

Iota

Kappa

Lambda

Omikron

SPECIES

↓

Within each genus (e.g. Alpha-9 species = HPV16)

TYPE

↓

> 10% L1 ORF divergence from closest known type

SUBTYPE

↓

2-10% L1 ORF divergence

VARIANT

↓

< 2% L1 ORF divergence (e.g. HPV16 lineages A-D)

Complete HPV Classification Table

HPV Evolution & Phylogeography

Co-speciation with vertebrate hosts, lineage migration with human populations, and evolutionary origin of Papillomaviridae.

Taxonomic History: Papillomaviridae was previously classified under Papovaviridae alongside Polyomaviridae. The ICTV formally separated the two families in 2000-2005, reflecting fundamental differences in genome organisation, replication strategy, and evolutionary history. (Bernard HU et al., 2010; ICTV)

Evolutionary Timeline

~330 million years ago

Earliest papillomavirus-like sequences in vertebrates (estimated)

PVs among the most ancient non-retroviral DNA viruses

~120–160 million years ago

Diversification with amniote radiation; reptile/bird PVs diverge

Host-virus co-evolution tightly linked to vertebrate evolution

~100 million years ago

Mammalian PV radiation begins; co-speciation hypothesis

Papillomaviridae family diversification

~65–70 million years ago

Primate PV diversification; Alpha/Beta genera separate

Mucosal vs. cutaneous tropism divergence

~20–40 million years ago

Hominid-specific HPV types emerge (HPV16-like ancestral lineage)

Human-specific HPV types evolve with Homo lineage

Present

>200 PV types identified across Papillomaviridae

Continued discovery via metagenomics

HPV16 Lineage Human Migration Patterns

Co-migration hypothesis: HPV16 lineages closely mirror human mitochondrial DNA population structure. Lineage A reflects Out-of-Africa migration (~60,000 BP), Lineage B/C are African-specific, and Lineage D follows Beringian migration to the Americas. (Schiffman M et al., 2010; Chen Z et al., 2011)

Lineage	Associated Human Population	Modern Geographic Distribution
A	European/Asian populations (Out-of-Africa migration ~60,000 BP)	Global (most common); A1 dominant in Europe, A3/A4 in Asia
B	Sub-Saharan African populations	African continent; rare outside
C	West/Central African populations	West Africa mainly
D	Native American + North American populations (Beringian migration)	Americas; highest in indigenous populations

Co-speciation Evidence

Strong phylogenetic congruence between PV tree and host mammalian tree

Alpha-PVs in great apes closely related to human Alpha-HPVs

Beta-HPVs show host-specificity (human Beta-HPV ≠ primate Beta-HPV)

Gamma-HPVs primarily human-restricted cutaneous types

Mitochondrial DNA analysis of Homo sapiens migration correlates with HPV16 lineage A/B/C/D distribution

Evolution References

Rector A & Van Ranst M (2013). Animal papillomaviruses. Virology 445(1-2):213-223.

Schiffman M et al. (2010). HPV16 variant lineages, viral persistence, and cervical neoplasia. Cancer Res 70(8):3159-69.

Chen Z et al. (2011). HPV types 16, 18, 31, 45 restricted to two phylogenetic lineages. J Virol.

Bernard HU et al. (2010). Classification of papillomaviruses. Virology 401(1):70-79.

ICTV Taxonomic Criteria (de Villiers et al., 2004 + ICTV 2023): A new HPV type requires >10% L1 ORF nucleotide divergence from the closest known type. A new species requires phylogenetic clustering + biological distinctiveness (~15-25% L1 divergence). A new genus requires major phylogenetic separation (>40% divergence) plus distinct genome organisation (e.g. E5 presence, ELR architecture). Intra-type lineages (A, B, C, D) and sub-lineages (A1, A2, B1...) differ by <2% L1 divergence.

Alphapapillomavirus Phylogenetics - Chen Z et al. 2018 Virology 516:86–101

PMC6093212 DOI: 10.1016/j.virol.2018.01.002 1,432 partial sequences 181 complete genomes 12 HPV types classified

Study scope

Alpha-5: HPV26, 51, 69, 82 - HR oncogenic clade

Alpha-6: HPV30, 53, 56, 66 - HR oncogenic clade

Alpha-11: HPV34, 73 - HR oncogenic clade

Alpha-13: HPV54 - Low-risk (monotypic)

Alpha-3: HPV61 - Low-risk (for comparison)

Tree method: Maximum likelihood (RAxML). Sequences: 6 concatenated ORFs (E6, E7, E1, E2, L2, L1) + URR. Outgroup: Saimiri sciureus PV 1/2/3.

Key findings

✓ HPV82 most diverse: 7.3% inter-lineage divergence (10 sublineages)

✓ HPV53 most complex Alpha-6: 4 lineages, D with 4 sub-lineages

✓ HPV26 most conserved: single lineage, 18 total nt changes

✓ NCR/URR most variable; L1 capsid most conserved across all types

✓ Certain lineages geographically structured (African enrichment in B/C)

✓ HPV64 reclassified as HPV34 lineage C (no longer distinct type)

✓ HPV69 separated from HPV82 - confirmed independent type

✓ Prototype 'errors' corrected for HPV51/53/54/56/69/82 references

Genomic diversity summary (Table 1 - Chen Z et al. 2018)

Type	Species	IARC	Partial n	Complete n	Genome (bp)	GC (%)	CpG sites	Lineages / Sublineages	Max divergence
HPV51	Alpha-5	Grp 1	233	22	7808–7816	38.9–39.2	140–145	A1–A4; B1–B2	~2.8%
HPV26	Alpha-5	Grp 2A	19	3	7855	38.6	145–146	A (single lineage)	<0.3%
HPV69	Alpha-5	Grp 2B	21	6	7700–7705	38.7–38.9	130–136	A1–A4	~3.0%
HPV82 ★	Alpha-5	Grp 2B	58	17	7870–7912	39.9–40.2	135–153	A1–A3; B1–B2; C1–C5	7.3% ★ max
HPV56	Alpha-6	Grp 1	260	6	7790–7866	37.9–38.0	129–134	A1–A2; B	~1.8%
HPV30	Alpha-6	Grp 2B	23	14	7843–7881	40.2–40.5	149–157	A1–A5; B	~3.5%
HPV53 ★	Alpha-6	Grp 2B	362	22	7856–7892	40.0–40.2	142–148	A; B; C; D1–D4	~4.2% (4 lin)
HPV66	Alpha-6	Grp 2B	146	10	7816–7824	38.3–38.5	128–136	A; B1–B2	~3.2%
HPV34	Alpha-11	Grp 3	25	14	7723–7790	37.8–38.2	118–125	A1–A2; B; C1–C2	~3.3%
HPV73	Alpha-11	Grp 2B	57	11	7697–7730	36.2–36.3 ★	106–109 ★	A1–A2; B	~1.5%
HPV54	Alpha-13	Grp 3 LR	121	8	7701–7760	41.8–42.0	142–154	A1–A2; B; C1–C2	~3.1%
HPV61	Alpha-3	Grp 3 LR	107	8	7989–8030 ★	45.9–46.4 ★	198–207 ★	A1–A2; B; C	~2.4%

★ = extreme value (highest/lowest) in study cohort. All inter-lineage divergence values calculated from complete genome pairwise alignments. PMC6093212

Fig. 1 - Phylogenetic tree of Alphapapillomavirus (Chen Z et al. 2018)

HR = α5,6,7,9,11 LR1 = α1,8,10,13 LR2 = α2,3,4,14

Phylogenetic tree of Alphapapillomavirus - Chen Z et al. 2018 Virology

Maximum likelihood tree (RAxML) of concatenated ORFs (E6, E7, E1, E2, L2, L1) + URR. Outgroup: Saimiri sciureus PV 1/2/3. Ancestral clades: HR (α5,6,7,9,11) | LR1 (α1,8,10,13) | LR2 (α2,3,4,14). Types in bold = sequenced in this study. Grey lines = non-human primate PVs.
© Chen Z, Schiffman M, Burk RD et al. 2018 Virology 516:86–101. NIHPA open-access (PMC6093212).

Geographic lineage associations - Chen Z et al. 2018

Sub-Saharan Africa

HPV51 B1, B2 - African enrichment

HPV82 B1, B2 - African enrichment

HPV53 D1, D2 - Highest in Africa

HPV56 B - Africa/Asia

HPV73 B - Africa-enriched

HPV34 B - Africa-enriched

Asia-Pacific

HPV51 A3, A4 - Asia-Pacific

HPV82 C3, C4 - Asian divergent

HPV53 C - Asia-Pacific

HPV30 A2, A3 - Asia-associated

HPV69 A2 - East Asia

HPV66 B2 - Asia - limited

Americas / Global

HPV51 A1, A2 - Global reference

HPV82 A1–A3 - Global reference

HPV53 D3 - Americas-associated

HPV30 A4, A5 - Americas rare

HPV69 A3 - Americas variant

HPV66 B1 - Africa/Americas

Alphapapillomavirus

ICTV Report

Host

Humans & non-human primates

Tissue Tropism

Mucosal & cutaneous epithelia

E5 Oncoprotein

Present (ELR region 300-500 bp) - unique to Alpha genus

Genome Size

~7.9-8.0 kb

ICTV Species

Risk Profile

Contains ALL 12 IARC Group 1 high-risk HPVs + low-risk genital types

Defining genomic feature: E5 oncoprotein present; contains all oncogenic HPV types

Clinical significance: Alpha-9 species group is the most oncogenic - HPV16 alone causes ~50-60% of cervical squamous cell carcinomas and ~60% of oropharyngeal squamous cell carcinomas globally. Alpha-7 (HPV18, HPV45) drives ~25% of cervical adenocarcinomas. Together, HPV16+18 account for ~70% of all cervical cancers, forming the basis of bivalent and quadrivalent vaccine design. Complete variant lineage classification for Alpha-7 types (HPV18, HPV39, HPV45, HPV59, HPV68, HPV70) was established by Chen Z et al. 2013 (PLoS ONE 8:e72565); Alpha-9 types (HPV16, HPV31, HPV33, HPV35, HPV52, HPV58, HPV67) by Chen Z et al. 2011 (PLoS ONE 6:e20183). HPV67 lineages (A1, A2, B) were further characterised in Japanese women by Kogure G et al. 2022 (Virol J 19:157; PMC9547447) - A1 was found in all cancer cases, with one A1 isolate bearing an in-frame E2 deletion.

How Alphapapillomavirus Are Discovered & Identified

Discovery history: Alpha-HPVs were the first human papillomaviruses characterised. Harald zur Hausen's group identified HPV16 and HPV18 from cervical carcinoma tissue using Southern blot hybridisation with radioactive probes (1983-1984), work that earned him the 2008 Nobel Prize in Physiology or Medicine. Consensus PCR primers - MY09/MY11 (Manos et al., 1989) targeting the L1 ORF (~450 bp amplicon) and the improved GP5+/GP6+ system (de Roda Husman et al., 1995, ~150 bp) - enabled broad-spectrum detection of the Alpha genus from cervical swabs. The formal Alpha genus classification was established by de Villiers et al. (2004, Virology 324:17-27) based on L1 phylogenetic clustering of 118 PV types, defining the 15 species groupings now recognised by ICTV.

ASSAYS VALIDATED FOR ALPHA-PV DETECTION:

GP5+/GP6+ consensus PCR (L1, ~150 bp) - gold standard for cervical screening research

MY09/MY11 degenerate PCR (L1, ~450 bp) - original consensus primers (Manos 1989)

PGMY09/PGMY11 pooled primers - 37-type coverage; basis for Roche Linear Array

SPF10 ultra-short primers (L1, 65 bp) - optimised for degraded FFPE tissue DNA

Hybrid Capture 2 (Digene/QIAGEN) - signal amplification; first FDA-approved HR-HPV test

Cobas HPV 4800 (Roche) - real-time PCR; detects 14 HR types; FDA-approved

APTIMA HPV (Hologic) - targets E6/E7 mRNA; higher specificity (active infections)

Roche Linear Array - reverse hybridisation; types 37 genotypes simultaneously

Seegene Anyplex II HPV28 - multiplex RT-PCR; 28 types

INNO-LiPA HPV Genotyping Extra - 28 probe hybridisation strip

Alphapapillomavirus - 13 Species | Genotypes | Lineages | Sub-lineages

Click any species row to expand genotypes and lineage data

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 1

Alphapapillomavirus 1

2 genotypes

HPV32 HPV42

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 1 (2 classified):

HPV32

HPV42

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 2

Alphapapillomavirus 2

10 genotypes

HPV125 HPV3 HPV28 HPV10 HPV94 +5 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 2 (10 classified):

HPV125

HPV3

HPV28

HPV10

HPV94

HPV117

HPV78

HPV29

HPV77

HPV160

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 3

Alphapapillomavirus 3

11 genotypes | lineage data: HPV61

HPV72 HPV61 HPV62 HPV81 HPV87 +6 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 3 (11 classified):

HPV72

HPV61

lineages

HPV62

HPV81

HPV87

HPV86

HPV114

HPV84

HPV83

HPV102

HPV89

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV61 A1	A	Global (reference)	Reference	None (ref)
HPV61 A2	A	Asia/Americas	Low-risk	1-3 changes
HPV61 B	B	Africa/global	Low-risk	Multiple
HPV61 C	C	Divergent global	Low-risk	Divergent

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 4

Alphapapillomavirus 4

3 genotypes

HPV2 HPV27 HPV57

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 4 (3 classified):

HPV2

HPV27

HPV57

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 5

Alphapapillomavirus 5

4 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV26, HPV51, HPV69, HPV82

HPV26 HPV51 HPV69 HPV82

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 5 (4 classified):

HPV26

pHR

lineages

HPV51

lineages

HPV69

pHR

lineages

HPV82

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV26 A	A	Global - limited data	Reference	None (ref) - 4 nonsynonymous changes in E1/E2/L1 across all 3 genomes

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV51 A1	A	Global (reference)	Reference	None (ref)
HPV51 A2	A	Europe/Americas	Similar to A1	1-3 aa changes
HPV51 A3	A	Asia-Pacific	Similar to A1	2-4 aa changes
HPV51 A4	A	Asia	Similar to A1	3-5 aa changes
HPV51 B1	B	Africa/African-derived	Potentially elevated	Multiple African-specific
HPV51 B2	B	Africa sub-Saharan	Potentially elevated	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV69 A1	A	Global (reference)	Reference	None (ref)
HPV69 A2	A	East Asia	Similar to A1	1-2 changes
HPV69 A3	A	Americas	Similar to A1	1-3 changes
HPV69 A4	A	Africa - limited data	Similar to A1	2-3 changes

HPV82

Alpha-5 | Group 2B (Possibly Carcinogenic)

LINEAGE HIERARCHY:

HPV82 A

Sub-lineages: HPV82 A1 HPV82 A2 HPV82 A3

HPV82 B

Sub-lineages: HPV82 B1 HPV82 B2

HPV82 C

Sub-lineages: HPV82 C1 HPV82 C2 HPV82 C3 HPV82 C4 HPV82 C5

Genus: Alphapapillomavirus

Species: Alpha-5

Genotype: HPV82

Lineages: HPV82 A, HPV82 B, HPV82 C

Sub-lineages: HPV82 A1, HPV82 A2, HPV82 A3, HPV82 B1, HPV82 B2, HPV82 C1, HPV82 C2, HPV82 C3, HPV82 C4, HPV82 C5, HPV82 HPV82: MOST DIVERSE in Alpha-5 - 3 lineages, 10 sublineages. Inter-lineage divergence 7.3% (highest in dataset). 17 complete genomes (n=58 partial). Genome: 7870-7912 bp; GC 39.9-40.2%; CpG 135-153. A1 = reference. C lineage (5 sublineages) is highly divergent; historically housed ME180-like variants. IARC Group 2B (possible HR). Former subtype designation AE2 abolished. Chen Z et al. 2018 Virology.

Clinical note: HPV82 (Alpha-5): IARC Group 2B (possible HR) and the MOST GENETICALLY DIVERSE type in the entire Chen Z et al. 2018 study - 10 sublineages across 3 lineages (A1-A3, B1-B2, C1-C5). Inter-lineage divergence 7.3% (maximum in dataset), approaching the 10% threshold used to define new types. 17 complete genomes + 58 partial sequences. Genome 7870-7912 bp (widest size range); GC 39.9-40.2%; CpG 135-153. The C lineage harbours 5 highly divergent sublineages and may represent ancient co-divergence with distinct human populations.

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV82 A1	A	Global (reference)	Reference	None (ref)
HPV82 A2	A	Asia-Pacific	Similar	1-3 changes
HPV82 A3	A	Americas	Similar	2-4 changes
HPV82 B1	B	Africa	Potentially elevated	Multiple
HPV82 B2	B	Africa sub-Saharan	Potentially elevated	Multiple
HPV82 C1	C	Divergent global	Unknown	Highly divergent (7.3% from A)
HPV82 C2	C	Divergent - Americas	Unknown	Highly divergent
HPV82 C3	C	Divergent - Asia	Unknown	Highly divergent
HPV82 C4	C	Divergent - Africa	Unknown	Highly divergent
HPV82 C5	C	Divergent - rare	Unknown	Highly divergent

References: Chen Z et al. 2018 Virology 516:86-101 (PMC6093212) · IARC Monographs Vol.100B (2012)

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 6

Alphapapillomavirus 6

4 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV30, HPV53, HPV56, HPV66

HPV30 HPV53 HPV56 HPV66

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 6 (4 classified):

HPV30

lineages

HPV53

pHR

lineages

HPV56

lineages

HPV66

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV30 A1	A	Global (reference)	Reference	None (ref)
HPV30 A2	A	Europe/Americas	Similar	1-2 changes
HPV30 A3	A	Asia	Similar	2-3 changes
HPV30 A4	A	Africa	Similar	2-4 changes
HPV30 A5	A	Americas - rare	Similar	3-5 changes
HPV30 B	B	Africa/global	Potentially different	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV53 A	A	Global (reference)	Reference	None (ref)
HPV53 B	B	Africa/global	Potentially elevated	Multiple
HPV53 C	C	Asia-Pacific	Similar	Multiple
HPV53 D1	D	Africa	Potentially elevated	Multiple
HPV53 D2	D	Africa sub-Saharan	Potentially elevated	Multiple
HPV53 D3	D	Americas	Similar	Multiple
HPV53 D4	D	Rare/divergent	Unknown	Highly divergent

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV56 A1	A	Global (reference)	Reference	None (ref)
HPV56 A2	A	Europe/Americas	Similar to A1	1-2 aa changes
HPV56 B	B	Africa/Asia	Potentially elevated	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV66 A	A	Global (reference)	Reference	None (ref)
HPV66 B1	B	Africa/Americas	Potentially elevated	Multiple
HPV66 B2	B	Asia - limited	Unknown	Multiple

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 7

Alphapapillomavirus 7

8 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV18, HPV39, HPV45, HPV59, HPV68, HPV70

HPV18 HPV39 HPV45 HPV59 HPV68 +3 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 7 (8 classified):

HPV18

lineages

HPV39

lineages

HPV45

lineages

HPV59

lineages

HPV68

lineages

HPV70

pHR

lineages

HPV85

pHR

HPV97

pHR

HPV18

Alpha-7 | Group 1 (Carcinogenic)

LINEAGE HIERARCHY:

HPV18 A

Sub-lineages: HPV18 A1 HPV18 A2 HPV18 A3 HPV18 A4 HPV18 A5

HPV18 B

Sub-lineages: HPV18 B1 HPV18 B2 HPV18 B3

HPV18 C

HPV18 C

Genus: Alphapapillomavirus

Species: Alpha-7

Genotype: HPV18

Lineages: HPV18 A, HPV18 B, HPV18 C

Sub-lineages: HPV18 A1, HPV18 A2, HPV18 A3, HPV18 A4, HPV18 A5, HPV18 B1, HPV18 B2, HPV18 B3, HPV18 C, HPV18 Chen Z et al. 2013 (PLoS ONE): 9 sublineages across 3 clades. A1 = reference (global/Asian-American). A2-A4 = European/Americas variants. A5 = divergent Thai variant. B1-B2 = African-1 (Af1); B3 = African-2 (Af2). C = novel clade from West/Central Africa (Burkina Faso/Rwanda); 23 defining SNPs. Adenocarcinoma dominant. Genome 7857 bp; GC 40.2%; intratype diversity 2.1%.

Clinical note: HPV18 accounts for ~15–20% of cervical cancers globally and is the dominant HPV type in cervical adenocarcinoma (~37% of adenocarcinomas). Chen Z et al. 2013 (PLoS ONE) sequenced 128 complete genomes (7857 bp) from women in Costa Rica, Taiwan, Thailand, Rwanda, Burkina Faso and Zambia, defining 9 sublineages across 3 major clades: A (A1–A5), B (B1–B3 corresponding to African-1/Af1 and African-2/Af2) and a newly identified lineage C. Genomic diversity spans 2.1% (422 variable nt sites; 5.4%). NCR2 (noncoding region between E5 and L2) is the most variable region at 11.6% diversity. L1 and E1 ORFs are the most conserved. Three indel events were identified across the genome: E2/E4 ORFs (6 bp deletion), NCR1 (19–20 bp deletion) and URR (7 bp deletion). Lineage B (Af1/Af2) is enriched in sub-Saharan Africa. Lineage C was first characterised in this study from Burkina Faso/Rwanda samples and is distinguished by 23 genome-wide SNPs (including G437A in E6 and T7475G in URR).

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV18 A1	A	Global/Asian-American (reference)	Reference	None (ref)
HPV18 A2	A	European variant	High	Minor E1/E2/URR SNPs
HPV18 A3	A	European (E2)	High	European E2 SNPs
HPV18 A4	A	Asian-American	High	Multiple Asian-American
HPV18 A5	A	SE Asia/Thailand	High	0.73–0.83% from other A variants
HPV18 B1	B	Africa - Af1 (Rwanda/Zambia)	High	Multiple African-1 specific
HPV18 B2	B	Africa - Af1 (Burkina Faso)	High	Multiple African-1 specific
HPV18 B3	B	Africa - Af2	High	Multiple African-2 specific
HPV18 C	C	West/Central Africa (novel)	High	23 lineage-specific SNPs

References: Chen Z et al. (2013) PLoS ONE 8(8):e72565 doi:10.1371/journal.pone.0072565 · Chen Z et al. (2009) J Virol 83:1443–1455 (HPV18/45/97 evolution) · de Sanjose S et al. (2010) Lancet Oncol · IARC Monographs Vol.100B (2012)

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV39 A1	A	Americas/Global (reference)	Reference	None (ref)
HPV39 A2	A	Americas/Taiwan	High	7 sublineage-specific SNPs; 9 aa E1 repeat
HPV39 B	B	Africa - Burkina Faso	High	35 lineage-specific SNPs

HPV45

Alpha-7 | Group 1 (Carcinogenic)

LINEAGE HIERARCHY:

HPV45 A

Sub-lineages: HPV45 A1 HPV45 A2 HPV45 A3

HPV45 B

Sub-lineages: HPV45 B1 HPV45 B2

Genus: Alphapapillomavirus

Species: Alpha-7

Genotype: HPV45

Lineages: HPV45 A, HPV45 B

Sub-lineages: HPV45 A1, HPV45 A2, HPV45 A3, HPV45 B1, HPV45 B2, HPV45 Chen Z et al. 2013 (PLoS ONE): 5 sublineages across 2 lineages. A1 = reference (global). A2 = Americas dominant (Costa Rica 37%). A3 = West African divergent variant (BF134); earliest split from A1/A2. B1 = Africa/Thailand (Rwanda 80%, Thailand 62%). B2 = Rwanda/Zambia. A/B distinguished by 42 SNPs. Genome 7858 bp; GC 39.7%; intratype diversity 1.5%. Disproportionate adenocarcinoma association.

Clinical note: HPV45 (Alpha-7) is closely related to HPV18 and is the third-ranking HPV type in cervical adenocarcinoma. Chen Z et al. 2013 (PLoS ONE) sequenced 24 complete genomes (7858 bp) from Costa Rica, Rwanda, Zambia, Burkina Faso and Thailand, defining 2 lineages with 5 sublineages: A1, A2, A3 and B1, B2. Genomic diversity is 1.5% (239/7858 variable nt sites; 3.0%). Lineage A and B variants are distinguished by 42 genome-wide SNPs. A3 is a newly described West African sublineage (isolate BF134) that diverges early from A1/A2 with 0.57–0.80% genome difference. HPV45 contributes ~5% of cervical cancers globally with a notably higher proportion among adenocarcinomas (~7–8%).

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV45 A1	A	Worldwide/Zambia (reference)	Reference	None (ref)
HPV45 A2	A	Americas (Costa Rica dominant)	High	20 sublineage-specific SNPs
HPV45 A3	A	West Africa - Burkina Faso	High	20 sublineage-specific SNPs (early divergence)
HPV45 B1	B	Africa/Thailand	High	17 sublineage-specific SNPs
HPV45 B2	B	Rwanda/Africa	High	17 sublineage-specific SNPs

References: Chen Z et al. (2013) PLoS ONE 8(8):e72565 doi:10.1371/journal.pone.0072565 · Godinez JM et al. (2013) Infect Genet Evol 13:96–104 · IARC Monographs Vol.100B (2012)

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV59 A1	A	Global (reference)	Reference	None (ref)
HPV59 A2	A	Americas - Costa Rica dominant	High	Multiple; 0.60–0.89% from other A variants
HPV59 A3	A	Americas variant	High	Multiple
HPV59 B	B	Africa (Rwanda/Burkina Faso)	High	53 lineage-specific SNPs

HPV68

Alpha-7 | Group 2A (Probably Carcinogenic)

LINEAGE HIERARCHY:

HPV68 A

Sub-lineages: HPV68 A1 HPV68 A2

HPV68 B

Sub-lineages: HPV68 B1 HPV68 B2

HPV68 C

HPV68 C

HPV68 D

HPV68 D

HPV68 E

HPV68 E

HPV68 F

HPV68 F

Genus: Alphapapillomavirus

Species: Alpha-7

Genotype: HPV68

Lineages: HPV68 A, HPV68 B, HPV68 C, HPV68 D, HPV68 E, HPV68 F

Sub-lineages: HPV68 A1, HPV68 A2, HPV68 B1, HPV68 B2, HPV68 A1 = reference. B lineage enriched in Africa. IARC Group 2A (probable HR). Chen Z et al. 2013.

Clinical note: HPV68 (Alpha-7) is an IARC Group 2A probably carcinogenic with the highest intratype genomic diversity of all Alpha-7 types. Chen Z et al. 2013 (PLoS ONE) sequenced 44 complete genomes (7850 bp) from Costa Rica, Taiwan, Rwanda, Burkina Faso and cell-line isolates, defining 6 lineages with 10 sublineages: A (A1, A2), B, C (C1, C2), D (D1, D2), E and F (F1, F2). Maximum intratype diversity is 6.7% (771/7850 variable nt sites; 9.8%) - the highest in the alpha-7 species group and exceptional among HPV types. The ME180 cell line, historically classified as a distinct HPV 'subtype', is now reclassified as variant lineages C–F of HPV68 (ME180-related clade). Lineages A and B (HPV68R prototype-related) are separated from lineages C–F (ME180-related) by a mean genome-wide difference of 6.38–6.61%. This extraordinary diversity raises questions about whether HPV68 variants have differing carcinogenic potentials. Genome size 7850 bp; GC content 40.7%.

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV68 A1	A	Americas/Global (reference - HPV68R prototype)	Reference	None (ref)
HPV68 A2	A	Americas/Global (HPV68R-related)	High	Minor SNPs from A1
HPV68 B	B	Africa/Global (HPV68R-related)	High	Multiple; HPV68R phylogeny
HPV68 C1	C	Asia/Africa (ME180-related)	High	Extensive; 6.38–6.61% from A/B
HPV68 C2	C	Asia/Africa (ME180-related)	High	Extensive; 6.38–6.61% from A/B
HPV68 D1	D	Africa (ME180-related)	High	Extensive; 6.38–6.61% from A/B
HPV68 D2	D	Africa (ME180-related)	High	Extensive; 6.38–6.61% from A/B
HPV68 E	E	Africa (ME180-related - novel lineage E)	High	Extensive; 6.38–6.61% from A/B
HPV68 F1	F	West Africa - Burkina Faso/Rwanda (ME180-related)	High	Extensive; 6.38–6.61% from A/B
HPV68 F2	F	West Africa - Burkina Faso/Rwanda (ME180-related)	High	Extensive; 6.38–6.61% from A/B

References: Chen Z et al. (2013) PLoS ONE 8(8):e72565 doi:10.1371/journal.pone.0072565 · Ong CK et al. (1993) J Gen Virol 74:2191–2197 (ME180 original characterisation) · IARC Monographs Vol.100B (2012)

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV70 A	A	Global - Africa dominant (Rwanda 82%), Americas (Costa Rica 65%)	Reference	None (ref)
HPV70 B	B	Global - minor lineage; Africa/Americas	Probably High	82 lineage-specific SNPs distinguishing B from A

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 8

Alphapapillomavirus 8

5 genotypes

HPV40 HPV7 HPV43 HPV71 HPV91

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 8 (5 classified):

HPV40

HPV7

HPV43

HPV71

HPV91

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 9

Alphapapillomavirus 9

7 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV16, HPV31, HPV33, HPV35, HPV52, HPV58, HPV67

HPV16 HPV31 HPV33 HPV35 HPV52 +2 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 9 (7 classified):

HPV16

lineages

HPV31

lineages

HPV33

lineages

HPV35

lineages

HPV52

lineages

HPV58

lineages

HPV67

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV16 A1	A	European/Global (reference)	Reference	None (ref)
HPV16 A2	A	European variant	High	H78Y
HPV16 A3	A	Asian	High	D25E, I27V
HPV16 A4	A	Asian-American	High	D25E, I27V, Q14H
HPV16 B1	B	African 1	Very High	L83V + others
HPV16 B2	B	African 1	Very High	L83V, G145T
HPV16 C	C	African 2	High	African-specific
HPV16 D1	D	North American	High	E-G350 variant
HPV16 D2	D	Asian-American	High	G350
HPV16 D3	D	Haitian/Latin American	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV31 A	A	Worldwide	Reference	None
HPV31 B	B	African/global	High	Multiple
HPV31 C	C	Asian	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV33 A1	A	Worldwide (reference)	Reference	None
HPV33 A2	A	European/Americas	High	Multiple
HPV33 B	B	African/Asian	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV35 A	A	Worldwide (reference)	Reference	None (ref)
HPV35 B	B	Sub-Saharan Africa - dominant	High	Multiple African-specific SNPs

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV52 A1	A	Global (reference)	Reference	None (ref)
HPV52 A2	A	Asia - East/Southeast Asia dominant	High	Multiple Asia-specific SNPs
HPV52 B1	B	Africa - sub-Saharan Africa	High	Multiple African-specific SNPs
HPV52 B2	B	Africa - secondary variant	High	Multiple African-specific SNPs
HPV52 C	C	Americas/Global	High	Multiple Americas-specific SNPs

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV58 A1	A	Worldwide	Reference	None
HPV58 A2	A	Asia-Pacific	High; common in E Asia	Multiple E6 changes
HPV58 A3	A	Americas	High	Multiple
HPV58 B1	B	African	High	Multiple
HPV58 B2	B	African-2	High	Multiple
HPV58 C	C	Asian	High	Multiple
HPV58 D	D	Americas-specific	High	Multiple

HPV67

Alpha-9 | Group 2B (Possibly Carcinogenic)

LINEAGE HIERARCHY:

HPV67 A

Sub-lineages: HPV67 A1 HPV67 A2

HPV67 B

HPV67 B

Genus: Alphapapillomavirus

Species: Alpha-9

Genotype: HPV67

Lineages: HPV67 A, HPV67 B

Sub-lineages: HPV67 A1, HPV67 A2, HPV67 B, HPV67 Chen Z et al. 2011 (PLoS ONE) + Kogure et al. 2022 (Virol J): A1 = reference (predominant in Japan - 9/12 isolates). A2 = minor sublineage (2/12 Japanese isolates). B = rare lineage (1/12 Japanese isolates). All cervical cancer cases in Kogure et al. were A1. One A1 cancer case harboured an in-frame E2 deletion. HPV67 LCR shows weak transcriptional activity in CaSki cells but not HeLa cells. Intratype diversity 1.1% (Chen 2011). Only 23 complete genomes documented globally prior to Kogure 2022 study. IARC Group 2A (probable HR). Alpha-9 species group. Sole alpha-9 type classified as probable rather than definite HR.

Clinical note: HPV67 (Alpha-9) is the sole member of the Alpha-9 species group classified as IARC Group 2B (possibly carcinogenic) rather than Group 1. All other Alpha-9 HR types (HPV16, 31, 33, 35, 52, 58) are Group 1. Chen Z et al. 2011 (PLoS ONE) established Alpha-9 lineage classification and estimated HPV67 intratype diversity at 1.1% (similar to HPV33 at 1.1% and HPV39 at 1.1%, and lower than HPV52 at 2.2%). Kogure G et al. 2022 (Virol J 19:157; PMC9547447) analysed 12 complete HPV67 genomes from Japanese women with cervical lesions - the largest single-study HPV67 genome dataset at that time - identifying sublineages A1 (75%), A2 (17%) and B (8%). All confirmed cervical cancer cases in the cohort were infected with sublineage A1. One cancer-associated A1 isolate harboured an in-frame deletion in E2, potentially disrupting viral episome maintenance. HPV67 LCR displayed weak transcriptional activity in CaSki cells (HPV16-positive cervical cancer line) but showed no activity in HeLa cells (HPV18-positive), a pattern distinct from confirmed Group 1 HR types. As of 2022, only 23 complete HPV67 genome sequences existed in international databases, reflecting its rare detection globally despite geographic documentation in Japan, Europe and sub-Saharan Africa. The epidemiological and molecular evidence collectively supports carcinogenic potential, though insufficient to warrant Group 1 classification at this time.

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV67 A1	A	Global - Japan dominant (75% of isolates)	Reference	None (ref); all cervical cancer-associated isolates are A1
HPV67 A2	A	Japan/Asia (minor sublineage)	Probably High	Minor SNPs from A1; 2/12 Japanese isolates
HPV67 B	B	Asia/Global (rare)	Probably High	Multiple; 1/12 Japanese isolates; rarest sublineage

References: Kogure G et al. (2022) Virol J 19:157 doi:10.1186/s12985-022-01886-3 PMC9547447 · Chen Z et al. (2011) PLoS ONE 6(5):e20183 doi:10.1371/journal.pone.0020183 · IARC Monographs Vol.100B (2012)

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 10

Alphapapillomavirus 10

5 genotypes

HPV74 HPV44 HPV13 HPV6 HPV11

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 10 (5 classified):

HPV74

HPV44

HPV13

HPV6

HPV11

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 11

Alphapapillomavirus 11

2 genotypes | lineage data: HPV34, HPV73

HPV34 HPV73

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 11 (2 classified):

HPV34

lineages

HPV73

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV34 A1	A	Global (reference)	Reference	None (ref)
HPV34 A2	A	Europe/Americas	Similar	1-3 changes
HPV34 B	B	Africa	Unknown	Multiple
HPV34 C1	C	Divergent global	Unknown	Highly divergent
HPV34 C2	C	Divergent - rare	Unknown	Highly divergent

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV73 A1	A	Global (reference)	Reference	None (ref)
HPV73 A2	A	Asia/Americas	Similar to A1	1-3 changes
HPV73 B	B	Africa	Potentially different	Multiple

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 13

Alphapapillomavirus 13

1 genotype | lineage data: HPV54

HPV54

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 13 (1 classified):

HPV54

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV54 A1	A	Global (reference)	Reference	None (ref - former AE9 genome)
HPV54 A2	A	Asia/Americas	Low-risk	1-3 changes
HPV54 B	B	Africa/global	Low-risk	Multiple
HPV54 C1	C	Divergent global	Low-risk	Divergent
HPV54 C2	C	Divergent - rare	Low-risk	Highly divergent

ICTV source: ICTV Report - Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 14

Alphapapillomavirus 14

3 genotypes

HPV106 HPV90 HPV71

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 14 (3 classified):

HPV106

HPV90

HPV71

ICTV source: ICTV Report - Alphapapillomavirus

Cross-Genus Comparison - Genomic, Biological & Epidemiological Differences

How genera differ from each other: Each genus represents a monophyletic L1-based clade with distinct genome architecture, tropism, clinical phenotype, and detectable with genus-optimised assays. No single consensus PCR detects all genera - multi-assay approaches are required for comprehensive surveillance.

Feature	Alpha-PV	Beta-PV	Gamma-PV	Mu-PV	Nu-PV
Tissue tropism	Mucosal + cutaneous	Cutaneous (EV/skin)	Cutaneous (plantar/palmar)	Cutaneous (plantar)	Cutaneous
E5 oncoprotein	✓ Present (ELR 300-500 bp)	✗ Absent (ELR <100 nt)	✗ Absent	✗ Absent (URR very large)	✗ Absent (ELR 17 nt only)
Carcinogenic types	Yes - IARC Group 1 (HPV16,18,31,33,45,52,58...)	EV/OTR cSCC (HPV5,HPV8)	None established	None	Possible (immunocomp.)
Primary detection assay	GP5+/GP6+, MY09/11, Cobas, APTIMA	FAP59/FAP64	Viral metagenomics / RCA-NGS	Type-specific PCR	Broad PCR + sequencing
Discovery era	1970s-present (zur Hausen)	1980s-present (EV patients)	2010s-present (metagenomics)	1977 (Orth et al.)	1986 (Grussendorf-Conen)
Cytoplasmic inclusions	Absent	Absent	✓ Distinctive eosinophilic	✓ Heterogeneous/filamentous	Absent
No. of human types	65+	~47	~100+	3	1
Lineages formally characterised	Yes (HPV16,18,31,33,45,52,58)	HPV5/8 variant analysis only	None established	None	None
ICTV species	13	5	27	3	1
Key clinical presentation	Genital warts, CIN, ICC, OPSCC	EV lesions, cSCC in OTR	Plantar/palmar warts	Deep plantar warts (myrmecia)	Cutaneous lesions
Genome size	~7.9-8.0 kb	~7.2-7.7 kb	~7.0-7.5 kb	~7.8-8.0 kb	~7.7 kb
E2 binding sites	Canonical ACCG motifs	Canonical	Canonical	Canonical	All sites modified

How Papillomavirus Genera Are Classified - The Science Behind Taxonomy

Core taxonomic rule: Genus assignment is phylogenetically driven - all PV types within a genus share >40% L1 ORF amino acid identity (approx. threshold), cluster monophyletically in maximum-likelihood trees, and share at least one biological/genomic feature distinguishing them from other genera (e.g., E5 presence, inclusion body morphology, ELR architecture, E2 binding site conservation).

Specimen Collection

Tissue biopsies (wart, lesion, cervix), swabs (genital, oral, skin, penile), or bulk environmental samples. Fresh-frozen, FFPE-fixed, or ethanol-preserved for DNA stability.

DNA Enrichment

Viral DNA enriched by ultracentrifugation, DNase treatment (removes linear host DNA), or phi29 rolling circle amplification (amplifies circular dsDNA genomes - ideal for intact HPV virions).

Sequencing

Illumina short-read (most common), Oxford Nanopore long-read (full ~7.9 kb in single read), or Sanger sequencing of cloned amplicons. Metagenomic approach uses random amplification without prior sequence knowledge.

Genome Assembly

De novo assembly (SPAdes, MEGAHIT). Contigs BLASTed against PaVE database (pave.niaid.nih.gov). >90% genome coverage + >10% L1 divergence = candidate novel type. Full circular genome required for ICTV submission.

Phylogenetic Placement

Maximum-likelihood phylogeny of L1 ORF sequences (MEGA, IQ-TREE, RAxML). Bootstrap support >70% for clade definition. Genus placement requires monophyletic clade membership AND biological feature congruence.

ICTV Submission

Complete genome deposited in GenBank + PaVE. ICTV PapillomaStudyGroup verifies: >10% L1 divergence for type status, genus assignment, assigns official name. Published in ICTV Reports (ictv.global).

HPV Full Reference Taxonomy

Source: hpvcenter.se

Complete ICTV-recognised HPV reference clone taxonomy. 231 genotypes · Genera: Alpha, Beta, Gamma, Mu, Nu · Source: HPV Reference Center, Karolinska Institutet

231 genotypes

Virus	Genus	Species	GenBank ID	Date Submitted	Submitted By	Reference
HPV1	Mu	Mu-1	V01116	1984	L. Gissman	Danos et al, 1982
HPV2	Alpha	Alpha-4	X55964	1984	L. Gissman	Hirsch-Behnam et al, 1990
HPV3	Alpha	Alpha-2	X74462	1984	L. Gissman	Delius and Hofmann, 1994
HPV4	Gamma	Gamma-1	X70827	1984	L. Gissman	Egawa et al, 1993
HPV5	Beta	Beta-1	M17463	1984	L. Gissman	Zachow et al, 1987
HPV6	Alpha	Alpha-10	X00203	1984	L. Gissman	Schwarz et al, 1983
HPV7	Alpha	Alpha-8	X74463	1984	L. Gissman and T. Oltersdorf	Delius and Hofmann, 1994
HPV8	Beta	Beta-1	M12737	1984	L. Gissman	Fuchs et al, 1986
HPV9	Beta	Beta-2	X74464	1984	L. Gissman	Delius and Hofmann, 1994
HPV10	Alpha	Alpha-2	X74465	1984	L. Gissman	Delius and Hofmann, 1994
HPV11	Alpha	Alpha-10	M14119	1984	L. Gissman	Dartmann et al, 1986
HPV12	Beta	Beta-1	X74466	1984	G. Orth via L. Gissman	Delius and Hofmann, 1994
HPV13	Alpha	Alpha-10	X62843	1984	L. Gissman	Van Ranst et al, 1992
HPV14	Beta	Beta-1	X74467	1984-10-22	G. Orth	Delius and Hofmann, 1994
HPV15	Beta	Beta-2	X74468	1984-10-09	G. Orth	Delius and Hofmann, 1994
HPV16	Alpha	Alpha-9	K02718	1984	M. Durst and L. Gissman	Seedorf et al, 1986
HPV17	Beta	Beta-2	X74469	1984-10	G. Orth	Delius and Hofmann, 1994
HPV18	Alpha	Alpha-7	X05015	1984	M. Boshart	Cole and anos, 1987
HPV19	Beta	Beta-1	X74470	1984-10	G. Orth	Delius and Hofmann, 1994
HPV20	Beta	Beta-1	U31778	1990-05-18	G. Orth	Kremsdorf et al, 1984
HPV21	Beta	Beta-1	U31779	1984-10	G. Orth	Kremsdorf et al, 1984
HPV22	Beta	Beta-2	U31780	1984	G. Orth	Kremsdorf et al, 1984
HPV23	Beta	Beta-2	U31781	1984-10	G. Orth	Kremsdorf et al, 1984
HPV24	Beta	Beta-1	U31782	1984-10	G. Orth	Kremsdorf et al, 1984
HPV25	Beta	Beta-1	X74471	1984-09-19	L. Gissman and H. Pfister	Delius and Hofmann, 1994
HPV26	Alpha	Alpha-5	X74472	1985-04-10	R. Ostrow	Delius and Hofmann, 1994
HPV27	Alpha	Alpha-4	X74473		R. Ostrow	Delius and Hofmann, 1994
HPV28	Alpha	Alpha-2	U31783	1986-04-23	G. Orth	Delius,H. Unpublished
HPV29	Alpha	Alpha-2	U31784	1986-04	G. Orth	Delius,H. Unpublished
HPV30	Alpha	Alpha-6	X74474	1985-04		Delius and Hofmann, 1994
HPV31	Alpha	Alpha-9	J04353	1985-02	A. Lorincz	Goldsborough at al, 1989
HPV32	Alpha	Alpha-1	X74475	1986-04	G. Orth	Delius and Hofmann, 1994
HPV33	Alpha	Alpha-9	M12732	1985-12-85	G. Orth	Cole and Streeck, 1986
HPV34	Alpha	Alpha-11	X74476	1985-12-03	G. Orth	Delius and Hofmann, 1994
HPV35	Alpha	Alpha-9	X74477	1986-10	A. Lorincz	Delius and Hofmann, 1994
HPV36	Beta	Beta-1	U31785	1986	G. Orth	Kawashima et al, 1986
HPV37	Beta	Beta-2	U31786	1986	W. Scheurlen	Scheurlen et al, 1986
HPV38	Beta	Beta-2	U31787	1986	W. Scheurlen	Scheurlen et al, 1986
HPV39	Alpha	Alpha-7	M62849	1987-09-21	G. Orth	Volpers and Streeck, 1991
HPV40	Alpha	Alpha-8	X74478	1987-09-21	E.M. de Villiers	Delius and Hofmann, 1994
HPV41	Nu	Nu-1	X56147	1987-09-21	E.M. de Villiers	Hirt et al, 1991
HPV42	Alpha	Alpha-1	M73236	1987-09-21	G. Orth	Philipp et al, 1992
HPV43	Alpha	Alpha-8	AJ620205	1987-07-29	A. Lorincz	Lorincz et al, 1989
HPV44	Alpha	Alpha-10	U31788	1987-07-29	A. Lorincz	Delius,H., Unpublished
HPV45	Alpha	Alpha-7	X74479	1986-03-28	Z. Naghashfar	Delius and Hofmann, 1994
HPV46			re-classified as HPV20 subtype
HPV47	Beta	Beta-1	M32305	1987-03-27	M. Ishibashi	Kiyono et al, 1990
HPV48	Gamma	Gamma-2	U31789	1987-11-17	L. Gissman	Muller et al, 1989
HPV49	Beta	Beta-3	X74480	1987-04-21	M. Favre	Delius and Hofmann, 1994
HPV50	Gamma	Gamma-3	U31790	1987-09-21	M. Favre	Favre et al, 1989
HPV51	Alpha	Alpha-5	M62877	1987-01-06	C. Crum	Lungu et al, 1991
HPV52	Alpha	Alpha-9	X74481	1987-05	W. Lancaster	Delius and Hofmann, 1994
HPV53	Alpha	Alpha-6	X74482	1987-11-17	L. Gissman	Delius and Hofmann, 1994
HPV54	Alpha	Alpha-13	U37488	1987-11-10	G. Orth	Delius,H., Unpublished
HPV55			re classified as HPV44 subtype	1987-11-10	M. Favre
HPV56	Alpha	Alpha-6	X74483	1987-09-30	A. Lorincz	Delius and Hofmann, 1994
HPV57	Alpha	Alpha-4	X55965	1989-06-26	E.M. de Villiers	Hirsch-Behnam et al, 1990
HPV58	Alpha	Alpha-9	D90400	1988-06-26	T. Matsukura	Kirii et al, 1991
HPV59	Alpha	Alpha-7	X77858	1989-01-02	T. Matsukura	Rho et al, 1994
HPV60	Gamma	Gamma-4	U31792	1989-01-02	T. Matsukura	Matsukura et al, 1992
HPV61	Alpha	Alpha-3	U31793	1989-03-01	T. Matsukura	Delius,H. Unpublished
HPV62	Alpha	Alpha-3	AY395706	1998-03-01	T. Matsukura	Fu et al, 2004
HPV63	Mu	Mu-2	X70828	1991-04-11	K. Egawa	Egawa et al, 1993
HPV64			re-classified as HPV34 subtype
HPV65	Gamma	Gamma-1	X70829	1989-01-02	T. Matsukura	Egawa et al, 1993
HPV66	Alpha	Alpha-6	U31794	1981-08-07	G. Orth	Delius,H., Unpublished
HPV67	Alpha	Alpha-9	D21208	1989-10-30	T. Matsukura	Kirii et al, 1998
HPV68	Alpha	Alpha-7	X67161	1981-03-14	G. Orth	Longuet et al, 1996
HPV69	Alpha	Alpha-5	AB027020	1991-09-09	T. Matsukura	Kino et al, 2000
HPV70	Alpha	Alpha-7	U21941	1993-02-19	G. Orth	Forslund and Hansson, 1996
HPV71	Alpha	Alpha-14	AB040456	1991-09-09	T. Matsukura	Matsukura and Sugase, 2001
HPV72	Alpha	Alpha-3	X94164	1993-10-11	Y. He	Volter et al, 1996
HPV73	Alpha	Alpha-11	X94165	1993-10-11	Y. He	Volter et al, 1996
HPV74	Alpha	Alpha-10	AF436130	1993-09-27	G. Orth	Burk and Terai, Unpublished
HPV75	Beta	Beta-3	Y15173	1994-10-05	V. Shamanin and E.M. de Villiers	Delius et al, 1998
HPV76	Beta	Beta-3	Y15174	1994-10-05	E.M. de Villiers	Delius et al, 1998
HPV77	Alpha	Alpha-2	Y15175	1995-07-31	V. Shamanin	Delius et al, 1998
HPV78	Alpha	Alpha-2	AB793779	1995-01-03	T. Matsukura	Sata et al, unpublished
HPV79			replaced by HPV91	1996-12-30	G. Orth	Terai and Burk, 2002
HPV80	Beta	Beta-2	Y15176	1995-07-31	K. Bergmann	Delius et al, 1998
HPV81	Alpha	Alpha-3	AJ620209	1996-08-06	T. Matsukura	Matsukura and Sugase, 2001
HPV82	Alpha	Alpha-5	AB027021	1997-01-20	T. Matsukura	Kino et al, 2000
HPV83	Alpha	Alpha-3	AF151983	1998-06-12	K.H. Fife and D. Brown	Brown et al, 1999
HPV84	Alpha	Alpha-3	AF293960	2000-04-05	R. Burk	Terai and Burk, 2001
HPV85	Alpha	Alpha-7	AF131950	1999-09-02	V. Chow	Chow and Leong, 1999
HPV86	Alpha	Alpha-3	AF349909	2000-09-01	R. Burk	Terai and Burk, 2001
HPV87	Alpha	Alpha-3	AJ400628	2000-08-31	S. Menzo	Menzo et al, 2001
HPV88	Gamma	Gamma-5	EF467176	2001-07-30	K. Egawa	Kullander et al, 2008
HPV89	Alpha	Alpha-3	AF436128	2001-08-27	R. Burk	Terai and Burk, 2002
HPV90	Alpha	Alpha-14	AY057438	2001-08-27	R. Burk	Terai and Burk, 2002
HPV91	Alpha	Alpha-8	AF419318	2001-08-27	R. Burk	Terai and Burk, 2002
HPV92	Beta	Beta-4	AF531420	2001-10-12	O. Forslund	Forslund et al, 2003
HPV93	Beta	Beta-1	AY382778	2002-02-12	O. Forslund	Vasiljevic et al, 2007
HPV94	Alpha	Alpha-2	AJ620211	2002-10-23	E.M. de Villiers	de Villiers et al, 2009
HPV95	Gamma	Gamma-1	AJ620210	2003-06-05	E.M. de Villiers and K. Egawa	Egawa et al, 2005
HPV96	Beta	Beta-5	AY382779	2002-10-04	O. Forslund	Vasiljevic et al, 2007
HPV97	Alpha	Alpha-7	DQ080080	2004-07-21	R. Burk	Chen and Burk, 2007
HPV98	Beta	Beta-1	FM955837	2004-07-15	E.M. de Villiers	de Villiers and Gunst, 2009
HPV99	Beta	Beta-1	FM955838	2004-07-15	E.M. de Villiers	de Villiers and Gunst, 2009
HPV100	Beta	Beta-2	FM955839	2004-07-26	E.M. de Villiers	de Villiers and Gunst, 2009
HPV101	Gamma	Gamma-6	DQ080081	2004-07-21	R. Burk	Chen et al, 2007
HPV102	Alpha	Alpha-3	DQ080083	2004-09-15	R. Burk	Narechania et al, 2005
HPV103	Gamma	Gamma-6	DQ080078	2004-09-15	R. Burk	Chen et al, 2007
HPV104	Beta	Beta-2	FM955840	2004-04-15	E.M de Villiers	de Villiers and Gunst, 2009
HPV105	Beta	Beta-1	FM955841	2004-08-04	E.M. de Villiers	de Villiers and Gunst, 2009
HPV106	Alpha	Alpha-14	DQ080082	2004-07-21	R. Burk	Narechania et al, 2005
HPV107	Beta	Beta-2	EF422221	2006-11-03	J. Kullander and O. Forslund	Vasiljevic et al, 2008
HPV108	Gamma	Gamma-6	FM212639	2006-11	R. Nobre and E.M. de Villiers	Nobre et al, 2009
HPV109	Gamma	Gamma-7	EU541441	2007-08-23	J. Kullander and O. Forslund	Ekstrom et al, 2010
HPV110	Beta	Beta-2	EU410348	2007-09-28	N. Vasiljevic and O. Forslund	Vasiljevic et al, 2008
HPV111	Beta	Beta-2	EU410349	2007-11-05	N. Vasiljevic and O. Forslund	Vasiljevic et al, 2008
HPV112	Gamma	Gamma-8	EU541442	2007-12-21	J. Kullander and O. Forslund	Ekstrom et al, 2010
HPV113	Beta	Beta-2	FM955842	2008-03-25	E.M. de Villiers	de Villiers and Gunst, 2009
HPV114	Alpha	Alpha-3	GQ244463	2008-11-14	J. Kullander and O. Forslund	Ekstrom et al, 2010
HPV115	Beta	Beta-3	FJ947080	2008-12-08	A. Giri	Chouhy et al, 2010
HPV116	Gamma	Gamma-9	FJ804072	2009-01-13	L. Li and E. Delwart	Li et al, 2009
HPV117	Alpha	Alpha-2	GQ246950	2009-07-02	I. Nindl	Kohler et al, 2010
HPV118	Beta	Beta-1	GQ246951	2009-07-02	I. Nindl	Kohler et al, 2010
HPV119	Gamma	Gamma-8	GQ845441	2009-07-15	R. Burk	Bernard et al, 2010
HPV120	Beta	Beta-2	GQ845442	2009-07-15	R. Burk	Bernard et al, 2010
HPV121	Gamma	Gamma-10	GQ845443	2009-07-15	R. Burk	Bernard et al, 2010
HPV122	Beta	Beta-2	GQ845444	2009-07-15	R. Burk	Bernard et al, 2010
HPV123	Gamma	Gamma-7	GQ845445	2009-07-15	R. Burk	Bernard et al, 2010
HPV124	Beta	Beta-1	GQ845446	2009-07-15	R. Burk	Bernard et al, 2010
HPV125	Alpha	Alpha-2	FN547152	2009-09-08	A. Kovanda, B. Kocjan and M. Poljak	Kovanda et al, 2011
HPV126	Gamma	Gamma-11	AB646346	2010-09-09	N. Egawa	Egawa et al, 2012
HPV127	Gamma	Gamma-12	HM011570	2009-11-20	C. Buck	Schowalter et al, 2010
HPV128	Gamma	Gamma-13	GU225708	2009-12-02	I. Nindl	Kohler et al, 2011
HPV129	Gamma	Gamma-9	GU233853	2009-12-02	I. Nindl	Kohler et al, 2011
HPV130	Gamma	Gamma-10	GU117630	2009-12-02	I. Nindl	Kohler et al, 2011
HPV131	Gamma	Gamma-14	GU117631	2009-12-02	I. Nidl	Kohler et al, 2011
HPV132	Gamma	Gamma-12	GU117632	2009-12-02	I. Nidl	Kohler et al, 2011
HPV133	Gamma	Gamma-10	GU117633	2009-12-02	I. Nidl	Kohler et al, 2011
HPV134	Gamma	Gamma-7	GU117634	2009-12-02	I. Nidl	Kohler et al, 2011
HPV135	Gamma	Gamma-15	HM999987	2009-12-07	R. Burk	Bottalico et al, 2011
HPV136	Gamma	Gamma-11	HM999988	2009-12-07	R. Burk	Bottalico et al, 2011
HPV137	Gamma	Gamma-16	HM999989	2009-12-07	R. Burk	Bottalico et al, 2011
HPV138	Gamma	Gamma-7	HM999990	2009-12-07	R. Burk	Chen et al, Unpublished
HPV139	Gamma	Gamma-7	HM999991	2009-12-07	R. Burk	Chen et al, Unpublished
HPV140	Gamma	Gamma-11	HM999992	2009-12-23	R. Burk and Z. Chen	Bottalico et al, 2011
HPV141	Gamma	Gamma-11	HM999993	2009-12-23	R. Burk and Z. Chen	Bottalico et al, 2011
HPV142	Gamma	Gamma-10	HM999994	2009-12-23	R. Burk and Z. Chen	Chen et al, Unpublished
HPV143	Beta	Beta-1	HM999995	2010-02-15	R. Burk and Z. Chen	Bottalico et al, 2011
HPV144	Gamma	Gamma-17	HM999996	2010-02-15	R. Burk and Z. Chen	Bottalico et al, 2011
HPV145	Beta	Beta-2	HM999997	2010-02-15	R. Burk and Z. Chen	Bottalico et al, 2011
HPV146	Gamma	Gamma-15	HM999998	2010-02-15	R. Burk and Z. Chen	Chen et al, Unpublished
HPV147	Gamma	Gamma-8	HM999999	2010-02-15	R. Burk and Z. Chen	Chen et al, Unpublished
HPV148	Gamma	Gamma-12	GU129016	2009-12-02	I. Nidl	Kohler et al, 2011
HPV149	Gamma	Gamma-7	GU117629	2009-12-02	I. Nidl	Kohler et al, 2011
HPV150	Beta	Beta-5	FN677755	2010-02-25	A. Kovanda, B. Kocjan and M. Poljak	Kovanda et al, 2011
HPV151	Beta	Beta-2	FN677756	2010-02-25	A. Kovanda, B. Kocjan and M. Poljak	Kovanda et al, 2011
HPV152	Beta	Beta-1	JF304768	2010-10-14	R. Burk and Z. Chen	Chen et al, unpublished
HPV153	Gamma	Gamma-13	JN171845	2011-02-24	H. Johansson and O. Forslund	Sturegard et al, 2013
HPV154	Gamma	Gamma-11	NC_021483	2011-03-31	O. Forslund and A. Ure	Ure and Forslund, 2014
HPV155	Gamma	Gamma-7	JF906559	2011-05-16	H. Johansson and O. Forslund	Bzhalava et al, 2013
HPV156	Gamma	Gamma-18	JX429973	2011-04-12	D. Chouhy	Chouhy et al, 2013
HPV157	Gamma	Gamma-12	KT698166	2012-05-29	D. Chouhy	Bolatti et al, 2016
HPV158	Gamma	Gamma-1	KT698168	2012-05-29	D. Chouhy	Bolatti et al, 2016
HPV159	Beta	Beta-2	HE963025	2012-07-12	B. Kocjan and M. Poljak	Kocjan et al, 2013
HPV160	Alpha	Alpha-2	AB745694	2012-09-06	T. Kiyono	Mitsuishi et al, 2013
HPV161	Gamma	Gamma-19	JX413109	2012-05-07	J. Li	Li et al, 2012
HPV162	Gamma	Gamma-19	JX413108	2012-05-07	J. Li	Li et al, 2012
HPV163	Gamma	Gamma-20	JX413107	2012-05-07	J. Li	Li et al, 2012
HPV164	Gamma	Gamma-8	JX413106	2012-05-07	J. Li	Li et al, 2012
HPV165	Gamma	Gamma-12	JX444072	2012-05-07	J. Li	Li et al, 2012
HPV166	Gamma	Gamma-19	JX413104	2012-05-07	J. Li	Li et al, 2012
HPV167	Gamma	Gamma-21	NC_022892	2012-05-07	J. Li	Li et al, 2012
HPV168	Gamma	Gamma-8	KC862317	2012-05-07	J. Li	Li et al, 2012
HPV169	Gamma	Gamma-11	JX413105	2012-05-07	J. Li	Li et al, 2012
HPV170	Gamma	Gamma-7	JX413110	2012-05-07	J. Li	Li et al, 2012
HPV171	Gamma	Gamma-11	KF006398	2012-12-08	Q. Feng	Martin et al, 2013
HPV172	Gamma	Gamma-22	KF006399	2012-12-08	Q. Feng	Martin et al, 2013
HPV173	Gamma	Gamma-1	KF006400	2012-12-08	Q. Feng	Martin et al, 2013
HPV174	Beta	Beta-2	HF930491	2013-03-06	B. Kocjan and M. Poljak	Kocjan et al, 2013
HPV175	Gamma	Gamma-23	KC108721	2013-06-18	H. Johansson and O. Forslund	Johansson and Forslund. 2014
HPV176	Gamma	Gamma-8	KR816167	2013-07-02	R. Burk	Chen and Burk. Unpublished.
HPV177	Alpha	Alpha-11	KR816168	2013-07-10	R. Burk	Chen and Burk. Unpublished.
HPV178	Gamma	Gamma-24	KJ130020	2013-07-12	H. Johansson and O. Forslund	Johansson and Forslund. 2014
HPV179	Gamma	Gamma-15	HG421739	2013-07-19	Hosnjak L., B. Kocjan and M. Poljak	Hosnjak et al, 2015
HPV180	Gamma	Gamma-10	KC108722	2013-07-25	H. Johansson and O. Forslund	Johansson and Forslund. 2014
HPV181	Gamma	Gamma-11	KR816169	2013-08-21	R. Burk	Chen and Burk. Unpublished.
HPV182	Beta	Beta-2	KR816170	2013-08-21	R. Burk	Chen and Burk. Unpublished.
HPV183	Gamma	Gamma-20	KR816171	2013-08-21	R. Burk	Chen and Burk. Unpublished.
HPV184	Gamma	Gamma-25	HG530535	2013-09-15	Hosnjak L., B. Kocjan and M. Poljak	Hosnjak et al, 2015
HPV185	Beta	Beta-5	KR816172	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV186	Gamma	Gamma-7	KR816173	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV187	Gamma	Gamma-26	KR816174	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV188	Gamma	Gamma-3	KR816175	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV189	Gamma	Gamma-7	KR816176	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV190	Gamma	Gamma-24a	KR816177	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV191	Gamma	Gamma-10	KR816178	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV192	Gamma	Gamma-15	KR816179	2013-10-17	R. Burk	Chen and Burk. Unpublished.
HPV193	Gamma	Gamma-7	KR816180	2014-01-22	R. Burk	Chen and Burk. Unpublished.
HPV194	Gamma	Gamma-20	KR816181	2014-01-22	R. Burk	Chen and Burk. Unpublished.
HPV195	Beta	Beta-1	KR816182	2014-01-22	R. Burk	Chen and Burk. Unpublished.
HPV196	Beta	Beta-1	KR816183	2014-01-22	R. Burk	Chen and Burk. Unpublished.
HPV197	Gamma	Gamma-24	KM085343	2014-04-14	S. Arroyo	Arroyo et al, 2014
HPV198	Beta	Beta-2	MG921179	2014-04-25	S. Arroyo	Arroyo et al, Unpublished
HPV199	Gamma	Gamma-12	KJ913662	2014-05-19	A. Ostrbenk, B. Kocjan and M. Poljak	Ostrbenk et al, 2015
HPV200	Gamma	Gamma-2	KP692114	2014-08-04	S. Arroyo	Arroyo et al, 2015
HPV201	Gamma	Gamma-27	KP692115	2014-08-04	S. Arroyo	Arroyo et al, 2015
HPV202	Gamma	Gamma-11	KP692116	2014-08-04	S. Arroyo	Arroyo et al, 2015
HPV203	Gamma	Gamma-7	MG921180	2014-10-13	S. Arroyo	Arroyo et al, Unpublished
HPV204	Mu	Mu-3	KP769769	2014-10-22	B. Kocjan and M. Poljak	Kocjan et al, 2015
HPV205	Gamma	Gamma-1	KT698167	2014-12-15	E. Bolatti	Bolatti et al, 2016
HPV206	Beta	Beta-1	U85660	2014-12-22	H. Pfister	Hopfl et al, 1997
HPV207	Gamma	Gamma-15	MK645900	2015-06-25	Bueno
HPV208	Gamma	Gamma-24a	MK645901	2015-06-25	Bueno
HPV209	Beta	Beta-2	KY242583	2016-02-19	E. Bolatti	Bolatti et al, 2017
HPV210	Gamma	Gamma-12	MH460956	2016-02-19	E. Bolatti	Bolatti et al, 2018
HPV211	Gamma	Gamma-8	MF509816	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV212	Gamma	Gamma-17	MF509817	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV213	Gamma	Gamma-13	MF509818	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV214	Gamma	Gamma-6	MF509819	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV215	Gamma	Gamma-9	MF509820	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV216	Gamma	Gamma-9	MF509821	2016-06-19	T. Meiring	Murahwa et al, 2019
HPV217		re-classified as HPV182 subtype	KY349817	2016-10-02	S. Dutta	Dutta et al, 2017
HPV218		re-classified as HPV189 subtype	KY780961	2016-10-02	S. Dutta	Dutta et al, 2017
HPV219	Gamma	Gamma-13	MH172376	2017-10-10	T. Meiring	Murahwa et al, 2018
HPV220	Gamma	Gamma-17	MH172377	2017-10-10	T. Meiring	Murahwa et al, 2018
HPV221	Gamma	Gamma-10	MH172378	2017-10-10	T. Meiring	Murahwa et al, 2018
HPV222	Gamma	Gamma-19	MH172379	2017-10-10	T. Meiring	Murahwa et al, 2018
HPV223	Gamma	Gamma-22	MG063749	2017-10-16	S. Dutta	Dutta et al, Unpublished
HPV224	Gamma	Gamma-8	MF356498	2017-10-16	S. Dutta	Brancaccio et al, 2017
HPV225	Gamma	Gamma-7	MG520499	2017-10-16	S. Dutta	Dutta et al, Unpublished
HPV226	Gamma	Gamma-6	MG813996	2018-01-24	J. Mossong	Latsuzbaia et al, 2018
HPV227	Beta	Beta-2	MK080568	2018-10-25	R. Brancaccio	Brancaccio et al, 2019
HPV228	Gamma	Gamma-27	ON482334	2019-08-21	C. Boukadida
HPV229	Gamma	Gamma-7	MW535770	2021-09-08	M. Rajeevan
HPV 230	Gamma	Gamma-15	OQ915151	2023-06-23	M. Rajeevan
HPV 231	Gamma	Gamma-10	OP577477	2023-06-23	M. Rajeevan

Key references: de Villiers EM et al. (2004) Virology 324:17-27 [foundational 118-type, 16-genus classification] | Bernard HU et al. (2010) Virology 401:70-79 [updated nomenclature] | Van Doorslaer K et al. (2023) ICTV Taxonomy Reports | PaVE database: Van Doorslaer K et al. (2017) Nucleic Acids Res 45:D499-D506 | ictv.global/report/papillomaviridae

HPV Cell Entry & Keratinocyte Infection

How HPV virions bind, enter, and infect stratified squamous epithelium - from initial attachment to nuclear delivery.

Key references: Horvath CAJ et al. (2010) Virol J ↗ | HPV cell entry review (2025) Heliyon ↗ | Front Microbiol (2025) ↗ | Clin Sci (2017) HPV replication cycle ↗

HPV Entry Pathway - Interactive Step-by-Step

Virion Synthesis

Differentiated keratinocytes (upper layers)

→

HSPG Binding

L1 & L2 bind heparan sulfate proteoglycans (syndecan-1/-4) on basal keratinocytes

→

Conformational Change

L2 N-terminus exposed; furin/proprotein convertase cleavage of L2

→

Transfer to α6-integrin

Virion transfers from HSPG to α6-integrin (secondary receptor); cyclophilin B involved

→

Endocytosis

Non-classical endocytic route (not clathrin, not caveolin); tetraspanin-enriched microdomains (TEMs)

→

Endosomal Escape

L2 penetrates endosomal membrane; acidic pH required; retrograde Golgi trafficking

→

Nuclear Delivery

L2-genome complex traffics to nucleus; L2 N-terminal NLS; delivery at mitosis (nuclear envelope breakdown)

Transformation zone specificity: HPV preferentially infects the cervical squamocolumnar junction (SCJ). Reserve cells at the SCJ express unique surface markers (CK7+, CD63+) that facilitate HPV binding and entry. This anatomical specificity explains why the SCJ is the origin of nearly all cervical cancers. Horvath et al. (2010) ↗

Microabrasion hypothesis: HPV does not infect intact epithelium. Microabrasions or microtrauma expose basal keratinocytes to virion contact. This explains the sexual transmission route - genital microtrauma during intercourse exposes basal cells at the SCJ to HPV virions.

HPV Lifecycle in Stratified Squamous Epithelium

Stratification-dependent lifecycle: HPV exploits keratinocyte differentiation programme. The virus establishes in basal cells (low E6/E7), amplifies in suprabasal cells (high E6/E7), and assembles/sheds in terminally differentiated cells (L1/L2 expressed). This avoids detection in proliferating basal layers.

Epithelial Layer	Cell Type	HPV Activity	Key Viral Proteins	Immune Detection
Basal layer	Proliferating stem/transit cells	Episomal maintenance; low copy (~10–50)	E1, E2 (replication); low E6/E7	Minimal - low antigen load
Suprabasal (early)	Post-mitotic differentiating cells	Genome amplification (100–1000 copies)	E6, E7 (high); E4, E5	Some innate recognition
Suprabasal (mid)	Intermediate differentiation	Vegetative amplification; E4 disrupts keratin	E4 dominant; E5	E4 cytopathic effect visible
Superficial layers	Terminally differentiating cells	Virion assembly; L1/L2 expressed	L1, L2; E4	Koilocyte formation; minimal immune
Surface/Desquamating	Anucleate squames	Virion release; koilocytes	L1 capsid	Virion shed into environment

Cell Entry & Lifecycle References

Horvath CAJ, Boulet GAV, Renoux VM, Delvenne PO, Bogers JPJ. (2010). Mechanisms of cell entry by HPVs: an overview. Virol J 7:11.

HPV cell entry mechanisms - comprehensive review (2025). Heliyon.

HPV entry and innate immune sensing (2025). Front Microbiol 16:1633283.

McBride AA (2017). The human papillomavirus replication cycle and its role in cancer progression. Clin Sci 131(17):2201–2221.

Doorbar J et al. (2012). The biology and life-cycle of HPVs. Vaccine 30(Suppl 5):F55–F70.

HPV Genome Organisation & Gene Functions

Detailed description of HPV genomic architecture, early and late genes, and their roles in the viral life cycle and carcinogenesis.

Genome basics: HPV has a circular, double-stranded DNA genome of approximately 7,200–8,000 bp. It encodes 8 principal ORFs: 6 early (E1, E2, E4, E5, E6, E7) and 2 late (L1, L2), plus a non-coding Long Control Region (LCR, also called URR - Upstream Regulatory Region). The genome is entirely protein-coding on one strand.

Genome Map (Linearised for display, not to scale)

Circular dsDNA ~7.9 kb | All ORFs on one strand | Click genes for details

LCR/URR

Click a gene block above to see details (interactive in Shiny version)

Gene Function Summary Table

Gene	Size	Classification	Primary Function	Carcinogenic Role	Present in Genera
LCR/URR	~400–1000 bp	Regulatory	Origin of replication; transcription regulation; E2 binding sites	Lineage-specific variants affect E6/E7 expression levels	All genera
E6	~450 bp	Early	p53 degradation (HR); PDZ protein disruption; telomerase activation	Critical oncogene: p53 loss → immortalisation	All genera
E7	~294 bp	Early	pRb degradation; E2F release; centrosome duplication	Critical oncogene: pRb loss → cell cycle dysregulation	All genera
E1	~1950 bp	Early	DNA helicase; replication initiation	Viral replication - indirect role	All genera
E2	~1200 bp	Early	Transcriptional repressor of E6/E7; replication factor	Integration disrupts E2 → E6/E7 derepression	All genera
E4	~276 bp	Early/Late	Keratin disruption; virion release	Facilitates viral shedding	All genera
E5	~249 bp	Early	EGFR activation; growth factor signalling	Promotes early transformation	Alpha only
L2	~1290 bp	Late	Minor capsid; DNA encapsidation; nuclear import	Cross-neutralising vaccine target	All genera
L1	~1590 bp	Late	Major capsid protein (icosahedral T=7); type-defining sequence	VLP vaccine antigen; type classification basis	All genera

High-Risk vs Low-Risk HPV - Molecular & Immuno-Pathological Differences

Core concept: The distinction between HR-HPV and LR-HPV is not simply a clinical one - it is rooted in fundamental molecular differences in E6 and E7 protein function, p53/pRb binding affinity, immune evasion capacity, and integration potential. These differences determine whether infection remains productive (LR) or progresses toward immortalisation and carcinogenesis (HR).

E6

Oncoprotein - HR vs LR Functional Divergence

⚠ HIGH-RISK E6 (HPV16, HPV18, HPV31, HPV45...)

p53 degradation: Contains LXXLL motif enabling E6-AP (UBE3A) ubiquitin ligase recruitment → ubiquitin-proteasomal degradation of p53 → loss of apoptosis and cell cycle arrest
hTERT activation: Binds and activates telomerase reverse transcriptase promoter → cellular immortalisation
PDZ domain proteins: C-terminal PBM (PDZ-binding motif) present - targets DLG1, SCRIB, MAGI-1/2/3 → disrupts cell polarity and tight junctions
STING/IFN suppression: Targets IRF3, STING → suppresses innate interferon response
BAK/BAX apoptosis: Binds and degrades pro-apoptotic BAK → blocks intrinsic apoptosis
Specificity: HPV16 E6 has ~100× higher p53-binding affinity than LR-HPV E6

✓ LOW-RISK E6 (HPV6, HPV11, HPV42, HPV44...)

No p53 degradation: LR-HPV E6 lacks high-affinity E6-AP interaction - p53 NOT efficiently degraded; p53-mediated apoptosis intact
No hTERT activation: Cannot activate telomerase → no immortalisation mechanism
No PBM motif: C-terminal PDZ-binding motif absent (HPV6/11 E6) → no PDZ protein disruption, cell polarity maintained
Limited immune evasion: Weaker suppression of innate immune signalling
Productive infection preferred: Promotes virion production rather than integration → condylomata, papillomas
Key ref: Pim D & Banks L (2010). HPV-18 E6*I protein targets a novel cellular protein, PTPN13, using a novel LXXLL motif. Oncogene.

E7

Oncoprotein - Binding Affinity & Downstream Effects

⚠ HIGH-RISK E7

pRb degradation: HR-E7 contains high-affinity LxCxE motif (CR2 domain) binding pRb, p107, p130 → ubiquitin-proteasomal degradation → unrestricted E2F activity
Binding affinity: HPV16 E7–pRb Kd ~7 nM; HPV6 E7–pRb Kd ~470 nM (~67× lower affinity)
p16INK4a: pRb loss triggers p16 overexpression (feedback) - clinically used as IHC biomarker for HR-HPV transformation
Centrosome amplification: HR-E7 induces centrosome duplication defects → chromosomal instability (CIN)
HDAC targeting: Binds HDAC1/2 → epigenetic dysregulation of tumour suppressors

✓ LOW-RISK E7

Weaker pRb binding: LR-E7 binds pRb with much lower affinity - sufficient to extend cell cycle for productive viral replication but insufficient for stable transformation
No pRb degradation: LR-E7 does NOT proteolytically degrade pRb - merely displaces E2F; pRb levels remain normal
No p16 overexpression: pRb intact → p16INK4a feedback not triggered → p16 IHC negative
Minimal chromosomal instability: Limited centrosome effects → stable genome in LR-HPV infected cells
Key ref: Münger K et al. (1989) The E7 gene product of the HPV-16 is sufficient for transformation of NIH 3T3 cells. EMBO J.

Genomic Integration - A HR-HPV-Specific Event

HR-HPV: Integration Mechanism

Circular episomal DNA linearises preferentially within E1/E2 ORFs → integration into host chromosomes. E2 disruption → loss of E6/E7 repression → oncogenic overexpression. Integration sites often near chromosomal fragile sites (8q24/MYC, 3q28/TP63).

LR-HPV: Episomal Maintenance

LR-HPVs (HPV6, HPV11) remain episomal throughout their life cycle. Integration is extremely rare and does not drive transformation. E2 intact → E6/E7 repressed → productive virion-generating infection maintained.

LCR Sequence Divergence

HR-HPV LCR contains AP-1 (c-jun/c-fos) binding sites that respond to inflammatory stimuli → enhanced E6/E7 transcription. Lineage variants show different LCR promoter strengths - Lineage B LCR drives higher E6/E7 expression than Lineage A (contributes to differential carcinogenicity).

Immune Evasion - HR vs LR Capacity

Mechanism	HR-HPV (16, 18...)	LR-HPV (6, 11...)	Clinical Consequence
IFN-β suppression	Strong (E6→IRF3; E7→STING)	Weak	HR: delayed innate response; prolonged persistence
MHC-I downregulation	E7 represses TAP1/2/MHC-I	Minimal	HR: CTL evasion; LR: normal antigen presentation
Langerhans cell induction	Suppressed	Moderate	HR: impaired adaptive priming
PD-L1 upregulation	E7 induces PD-L1	Absent	HR: T-cell exhaustion; LR: none
Viral shedding	Reduced (episomal loss)	High (productive)	LR produces more virus; HR persists silently
Seropositivity rate	50–60% natural infection	70–80% condylomata	LR: stronger antibody response due to high antigen load

Key references: Jain M et al. (2023) Pathogens 12:1380 ↗ | Nature Signal Transduction (2024) ↗ | Münger K et al. (1989) EMBO J 8:4099 | Pim D & Banks L (2010) Oncogene | zur Hausen H (2009) Nat Rev Cancer 9:798–805

Immune Response & Host-HPV Interactions

Innate and adaptive immunity against HPV, immune evasion strategies, and immunopathogenesis.

Key reviews: Stanley MA (2025) Front Immunol ↗ | Bhattacharya N et al. (2019) Translational Oncology ↗

Innate Immune Response to HPV

🛡 Pattern Recognition & IFN Response

Keratinocytes: primary innate responders - TLR2, TLR4, TLR9 signalling
HPV dsDNA genome activates cGAS-STING pathway → IFN-β induction
HR-HPV E6/E7 actively suppress innate responses:
E6 degrades STING; inhibits TBK1/IRF3 signalling
E7 inhibits IRF1 and NF-κB - reduces IFN production
This suppression allows viral persistence and immune evasion

🔴 NK Cells & Innate Lymphocytes

NK cell activity reduced in HPV-infected epithelium
HPV downregulates NKG2D ligands → impairs NK recognition
Langerhans cells (LC) in stratified epithelium: first APC encounter
HPV L2 inhibits LC migration to lymph nodes
Result: delayed and suboptimal early immune activation

Adaptive Immune Response

CD4+ T Helper Cells

HPV-specific Th1 response critical for viral clearance
Th1: IFN-γ, TNF-α → cytotoxic response enhancement
Th2 skewing in persistent HPV infection
Treg expansion impairs effective clearance
E6/E7-specific T cells detectable years post-infection

CD8+ CTL Response

MHC-I restricted E6/E7 epitope presentation
HPV16 E6/E7 well-characterised CTL epitopes (HLA-A*02:01)
HR-HPV E7 downregulates MHC-I expression
TAP (transporter) inhibition by E5
Tumour microenvironment: exhausted T cells (PD-1+, Tim-3+)

B Cell / Antibody Response

Natural infection: low-titre anti-L1 IgG in ~70% women
Anti-L2 antibodies: broad cross-reactive, low-titre
Seroconversion may take months post-infection
No evidence antibodies drive clearance of established HPV
Vaccine: high anti-L1 VLP IgG; memory B cells persist

HPV Immune Evasion Mechanisms: HR-HPV has evolved multiple strategies to evade host immunity, explaining why chronic persistent infection occurs in ~10–15% of infected individuals and progresses to cancer over decades.

Viral Protein	Immune Evasion Mechanism	Target Pathway	Consequence
E6	Degradation of STING, IRF3 inhibition	cGAS-STING / IFN pathway	Suppressed IFN-β; impaired innate sensing
E6	p53 degradation	Apoptosis pathway	Prevents apoptotic clearance of infected cells
E7	IRF1 and NF-κB inhibition	Innate/adaptive immune signalling	Reduced IFN and cytokine production
E7	MHC-I downregulation via TAP inhibition	CTL antigen presentation	Reduced cytotoxic T cell recognition
E7	Treg induction	Adaptive immune regulation	Immunosuppressive tumour microenvironment
E5	MHC-I downregulation	Antigen presentation	Impaired CD8+ T cell killing
L2	Langerhans cell migration inhibition	Antigen-presenting cells	Delayed adaptive immune priming
Viral lifecycle	Capsid proteins expressed only in superficial cells	Immune surveillance	Avoids innate detection in basal layer

Immune Response References

Stanley MA et al. (2025). HPV immunity and immunopathogenesis. Front Immunol 16:1591297.

Bhattacharya N et al. (2019). Immune evasion in HPV-related cancers. Transl Oncol 12(9):1136–1147.

Jain M et al. (2023). Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape. Pathogens 12(12):1380.

HPV Interactome

From infection epidemiology to co-detection pairs to network science: a unified view of HPV genotype interactions.

Why network science? Co-detection pairs are the empirical foundation of the HPV interactome. When HPV types repeatedly co-occur in the same lesion at frequencies higher than expected by chance, they form network edges. The topology of these edges - which genotypes act as hubs, which cluster phylogenetically, which are structurally proximal to HPV16 - constitutes independent biological evidence for oncogenic risk, beyond IARC's carcinogenicity classifications.

HPV Infection Prevalence by Pattern - Multi-Study Comparison

General population estimates (General Women & Men) derived from WHO/ICO HPVcentre and Lancet GH 2023 meta-analysis (n=44,769 men, 65 studies). HIV+ Women: Stelzle et al. 2025 (JID). FSW: BMC Public Health 2020 meta-analysis (n=21,402, 62 studies).

Single vs. Multiple Infection Prevalence Across Key Studies

Study / Data Source	Population	Region	Single Infection	Multiple Infection	PMCID / DOI
Zeng et al. 2025 (S. China, n=196,103)	General Women	East Asia	82.1%	17.9%	PMC12522608
Chengdu Study 2025 (n=51,556)	Gynecol Outpatients	East Asia	60.6%	39.4%	Front2025
Yangpu Shanghai 2025 (n=19,142)	Gynecol Outpatients	East Asia	71.3%	28.7%	PMC12232720
Fan et al. 2020 (China 8 cities, n=137,943)	Gynecol Outpatients	East Asia	74.2%	25.8%	PMC7154087
Chaturvedi et al. 2011 (Costa Rica CVT, n=5,871)	Young Women 18-25y	Latin America	56.8%	43.2%	PMC3068034
BMC Infect Dis 2023 (Sichuan, n=20,059)	Screened Women	East Asia	75.3%	24.7%	SpringerBMC2023
FSW Meta-analysis 2020 (n=21,402 FSW)	Female Sex Workers	Global	57.4%	42.6%	BMCPubHealth2020
Men Global 2023 (n=44,769 men)	General Men	Global	69%	31%	LancetGH2023

HPV Infection Patterns by Population, Sex, Age & HIV Status

Key finding: HPV infection burden is dramatically higher in high-risk groups. HIV-positive MSM have ~8× higher any-HPV prevalence than heterosexual men, and people with HIV have 2–6× higher cervical/anal HPV prevalence than HIV-negative counterparts. These disparities directly shape the co-infection network topology.

General Women (Global estimates)

11.7%

Any HPV

9.5%

HR-HPV

22%

Multi-type

WHO/ICO HPVcentre global estimates

Women with HIV (Global estimates)

45%

Any HPV

40%

HR-HPV

45%

Multi-type

Stelzle et al. 2025 JID; PWH burden review

HIV+ MSM (Anal; Tianjin 2024)

62%

Any HPV

50%

HR-HPV

35%

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Anal; Tianjin 2024)

53.7%

Any HPV

38%

HR-HPV

28%

Multi-type

Front PubHealth 2024 (Tianjin China)

Female Sex Workers (Pooled global meta-analysis)

42.6%

Any HPV

28%

HR-HPV

40%

Multi-type

BMC PubHealth 2020 meta-analysis (n=21,402; 62 studies)

MSW/Heterosexual Men (Tianjin 2024)

8.3%

Any HPV

5.5%

HR-HPV

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Multi-site; Gardasil trial)

48%

Any HPV

35%

HR-HPV

28%

Multi-type

PMC3086446 (Gardasil trial MSM)

General Men (Global meta-analysis)

31%

Any HPV

21%

HR-HPV

Multi-type

Lancet GH 2023 meta-analysis (n=44,769; 65 studies)

HPV Prevalence by Region & Population Type - Key Data Points

Region	Population	Any HPV (%)	HR-HPV (%)	Multiple Infections (%)	Notable Genotypes	Reference
East Asia (China)	General women	11–23%	9–17%	18–28%	HPV52, HPV16, HPV58	Fan 2020; Zeng 2025
Latin America	Young women 18–25y	42% HPV+	-	43%	HPV51, HPV52, HPV16	CVT Chaturvedi 2011 JID
Sub-Saharan Africa	HIV+ women	65–85%	55–75%	40–55%	HPV16, HPV35, HPV18, HPV45	Stelzle et al. 2025 JID
Global (MSM)	MSM HIV+	62–83%	50–70%	35–55%	HPV16, HPV6/11, HPV52, HPV58	Front PubHealth 2024
Global (FSW)	Female sex workers	42.6% (pooled)	28%	40%	HPV16, HPV52, HPV18	BMC PubHealth 2020 meta
Global (Men)	General men	31%	21%	~25%	HPV16, HPV6	Lancet GH 2023 meta
South Asia (India)	FSW+MSM+IDU	69–73%	25%	-	HPV16, HPV18	PubMed 22631651
Europe (Spain)	Gynecol. outpatients	17–25%	14–17%	20–30%	HPV16, HPV31, HPV58	BMC Infect Dis 2009

Most Frequent Co-Detection Pairs - Evidence Base for Network Edges

Co-detection frequency relative prevalence within HPV+ co-infected samples | Citations from peer-reviewed studies

Network significance: Each pair below represents a potential network edge. Pairs with >3x expected co-occurrence (Fan et al. 2020) are marked with a star - these are structurally prioritised edges in HPV interactome models. Regional variation in dominant pairs reflects both population genetics and assay type.

HPV52+HPV53

East Asia

52%

Most frequent pair in Southern China (n=196,103); HPV53 probable HR-HPV; Zeng et al. 2025 Virol J [PMC12522608]

Zeng et al. 2025 Virol J (PMC12522608)

HPV52+HPV58

East/SE Asia

48%

Pan-regional; dominant in East & SE Asia; Alpha-9 cluster synergy; Zeng 2025; BMC Infect Dis 2023

Zeng 2025; BMC Infect Dis 2023

HPV52+HPV16

East Asia

45%

Top pair in Chengdu (n=51,556; 106 cases) & BMC Infect Dis (51 cases); both Alpha-9 HR-HPVs

Frontiers PubHealth 2025; BMC Infect Dis 2023

HPV51+HPV52

Latin America

52%

Most frequent combination in Mexico City (51.93%); Alpha-5+Alpha-9 cross-genus; BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV16+HPV31

East Asia

38%

3.5x higher than expected by chance; Alpha-9 phylogenetic affinity; Fan et al. 2020 Front Oncol [PMC7154087]

Fan et al. 2020 Front Oncol (PMC7154087)

HPV18+HPV31

East Asia

43%

4.3x higher than expected by chance; highest OR in China 137k nationwide study; Fan et al. 2020

Fan et al. 2020 Front Oncol

HPV58+HPV33

East Asia

43%

Second most frequent in Shanghai (12.9%); both Alpha-9; Cambridge Epidemiol Infect 2015

Cambridge Epidemiol Infect 2015

HPV16+HPV18

Global

45%

Highest combined cancer risk; E6/E7 dual oncogenesis; both IARC Group 1 HR-HPVs

Multiple global studies

HPV16+HPV33

Europe/Lat Am

35%

Alpha-9 cluster; frequent in Mexico & Spain; both HR-HPV; BMC Cancer 2017; BMC Infect Dis 2009

BMC Cancer 2017; BMC Infect Dis 2009

HPV16+HPV51

East Asia

35%

Common in Chengdu (70 cases) and MSM cohorts; Alpha-9 intra-cluster; Front Public Health 2025

Frontiers PubHealth 2025

HPV16+HPV58

East Asia

32%

Frequent in Chengdu (68 cases) & Asia-Pacific; both Alpha-9 HR; Chengdu study 2025

Frontiers PubHealth 2025 (Chengdu)

HPV18+HPV45

Global

28%

Adenocarcinoma-associated pair; both Alpha-7; glandular lesion tropism

IARC/WHO classification studies

HPV52+HPV39

East Asia

28%

BMC Infect Dis 2023 (Sichuan): 35 cases; cross-species Alpha-9+Alpha-5; co-infection HSIL risk OR 3.18

BMC Infect Dis 2023 (Sichuan)

HPV31+HPV33

Global

25%

Alpha-9 intra-cluster; squamous lesion association; CIN2+ in multiple populations globally

Chaturvedi 2011 JID (PMC3068034)

HPV6+HPV11

Global

82%

Strongest benign co-detection pair (82%); both Alpha-10; anogenital warts; no malignant potential

Chaturvedi 2011 JID (PMC3068034)

HPV16+HPV6

Latin America

32%

LR+HR mixed; HPV6 facilitates HPV16 co-infection; BMC Cancer Mexico 2017 (p<0.001)

BMC Cancer 2017 (Mexico City)

HPV53+HPV66

Global

22%

Both probable HR-HPV; HPV53 Group 2B IARC; emerging pair in surveillance data worldwide

Surveillance data; IARC Group 2B

HPV35+HPV16

Latin America

18%

HPV35 specifically co-infects with HPV16 and HPV6 but not HPV51/52; Mexico BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV45+HPV16

Global

18%

Both Alpha-7; adenocarcinoma cluster; HPV45 frequently accompanies HPV16 in glandular lesions

Multiple adenocarcinoma studies

HPV82+HPV16

Global

15%

HPV82 Group 2B; co-detection with HPV16 in high-grade lesions; supports IARC reclassification

IARC/high-grade lesion studies

HPV Type Co-infection Preference - Preferred & Avoided Partners

Methodology: Co-infection preference is expressed as observed/expected ratio (OR). OR >1 = co-infection occurs more often than by random chance; OR >3 = strong affinity. These ORs form the weighted edges of the HPV interactome network. Source: Fan et al. 2020 Front Oncol; Chaturvedi et al. 2011 JID; BMC Cancer 2017; Zeng et al. 2025 Virol J.

HPV Type	Preferred Co-infectors (OR)	Avoidance	Lesion Context	Reference
HPV16	HPV31 (3.5x), HPV33 (3.1x), HPV51 (2.8x), HPV58 (2.5x)	HPV52 (low OR)	CIN1-3, ICC (dominant)	Fan 2020; CVT Chaturvedi 2011
HPV18	HPV31 (4.3x), HPV51 (3.2x), HPV33 (2.9x), HPV52 (1.9x)	HPV58 (low OR)	Adenocarcinoma, CIN2+	Fan 2020 Front Oncol
HPV52	HPV53 (4.1x), HPV58 (3.8x), HPV16 (3.2x), HPV51 (2.9x), HPV39 (2.5x)	-	CIN1-2, Asian populations	Zeng 2025; BMC Infect Dis 2023
HPV51	HPV52 (5.2x), HPV16 (2.8x), HPV56 (2.2x)	-	CIN1-2, multiple regions	BMC Cancer 2017 (Mexico)
HPV6	HPV11 (>10x), HPV16 (2.4x), HPV33 (2.2x)	-	Genital warts	Chaturvedi 2011 JID
HPV31	HPV16 (3.5x), HPV18 (4.3x), HPV33 (2.8x)	-	CIN1-3	Fan 2020 Front Oncol
HPV58	HPV33 (4.2x), HPV52 (3.8x), HPV16 (2.5x), HPV31 (2.2x)	-	CIN2+, Asian pop	Cambridge 2015; Chengdu 2025
HPV33	HPV58 (4.2x), HPV16 (3.1x), HPV6 (2.2x), HPV51 (2.0x)	HPV52 (low)	CIN1-3	Cambridge 2015; Fan 2020

HPV Co-occurrence Network - Interactome Visualisation

High-Risk

Low-Risk

Benign

Network approach: Nodes = HPV genotypes; edge weight = empirical co-detection frequency from literature. Node size reflects oncogenic risk. HPV16 is the dominant hub. HPV6/HPV11 form the strongest benign cluster (edge weight 0.82). HPV52 is the most connected node in East Asian population networks. Drag nodes to explore.

IARC reclassification context: If network edges are built from assay data before IARC correction, Group 2B types (HPV67, HPV70, HPV73) may be misclassified as low-risk and excluded from HR clusters. Post-correction network topology shifts measurably - quantifying this shift is a key research application of this interactome approach.

Network Science - Interpretation & Research Applications

Hub Node Analysis

HPV16 is the most central hub in HR-HPV networks - highest degree, betweenness and closeness centrality. HPV52 is the dominant hub in East Asian population networks. Hub genotypes should be prioritised in next-generation vaccines.

Cluster Topology

Alpha-9 (HPV16/31/33/52/58) and Alpha-7 (HPV18/39/45/68) cluster together. Alpha-10 (HPV6/11) form a benign cluster. Cross-cluster edges (e.g. HPV16-HPV51) are network bridges of high surveillance value.

Misclassification Detection

HPV70, HPV73, HPV67 and HPV82 (IARC Group 2B) cluster structurally with HR-HPV types in correctly-classified networks. This topological proximity is empirical network evidence for their reclassification, independent of IFU data.

Type Replacement Risk

Random co-infection pattern (Chaturvedi 2011 JID: pooled OR=2.2 for 300 type-type pairs) suggests vaccination does not redirect infection toward non-vaccine types. Network topology monitors this assumption post-9vHPV rollout.

Pathology & HPV-Induced Carcinogenesis

From histopathological classification and IARC risk stratification through molecular oncogenesis - the complete pathway from HPV infection to invasive carcinoma.

Key reviews: Jain M et al. (2023) Pathogens ↗ | Signal Transduction & Targeted Therapy (2024) ↗ | Front Immunol (2023) ↗

Histopathological Grading - CIN & Beyond

CIN / SIL Classification System

Grade	Old Term	Bethesda	Histology	HPV Type	Progression Risk
CIN 1	Mild dysplasia	LSIL	Koilocytosis; dysplastic cells in lower 1/3 of epithelium; basal layer intact	LR and HR-HPV	~10–15% progress to CIN3 over 2 years; ~60% regress spontaneously
CIN 2	Moderate dysplasia	HSIL	Dysplasia in lower 2/3; mitotic figures in middle third; loss of polarity	HR-HPV dominant	~20% progress to CIN3/ICC; ~40% regress
CIN 3 / CIS	Severe dysplasia / Carcinoma in situ	HSIL	Full-thickness dysplasia; basement membrane intact; p16 diffusely positive	HPV16/18 dominant	~30–40% progress to ICC if untreated over 10–15 years
ICC	Invasive Cervical Carcinoma	N/A	Basement membrane breached; stromal invasion; SCC or adenocarcinoma	HPV16 (SCC), HPV18/45 (adeno)	Stage-dependent 5-yr survival: Ia 93% → IVb <15%

E6 & E7 Oncoproteins - Molecular Mechanism

E6 & E7: The Two Master Oncoproteins

E6 Oncoprotein (HR-HPVs)

Binds E6-AP ubiquitin ligase → ubiquitinates p53
Proteasomal degradation of p53 → prevents apoptosis
Activates hTERT → cell immortalisation
Disrupts PDZ domain-containing proteins (DLG1, SCRIB, MAGI)
LR-HPV E6 does NOT efficiently degrade p53
Suppresses innate immunity via STING/IRF3

E7 Oncoprotein (HR-HPVs)

Binds and degrades pRb (LxCxE motif) → releases E2F → S-phase entry
HR-HPV E7 binds pRb ~10–67× more tightly than LR-HPV E7
Induces centrosome duplication → chromosomal instability
p16INK4a overexpression = surrogate biomarker for E7 activity
HPV integration disrupts E2 → E6/E7 derepression
Upregulates PD-L1 → T-cell exhaustion

Stepwise Progression: Infection → Invasive Cancer

7-Step Molecular Pathway to Invasive Carcinoma

STEP 1 : HPV INFECTION

HPV16/18 infects basal keratinocytes at transformation zone (cervical squamocolumnar junction). Entry via heparan sulfate proteoglycans (HSPG) → conformational change in L1/L2 → endocytosis. See Cell Entry page ↗

STEP 2 : EPISOMAL REPLICATION

HPV DNA maintained as extrachromosomal episome (~20–100 copies/cell). E1/E2 drive low-level replication. E6/E7 expressed at low levels. Cell remains viable - productive lifecycle initiated.

STEP 3 : PERSISTENT INFECTION

~10–15% of HR-HPV infections persist beyond 12 months. Risk factors: viral load, specific lineage (HPV16-B variants), immunosuppression, STI co-infections (BV, HIV, CT). Persistent infection = prerequisite for malignant progression.

STEP 4 : CHROMOSOMAL INTEGRATION

HPV DNA integrates into host genome. Preferential integration at chromosomal fragile sites (3q, 8q, 13q, 17q). Integration disrupts E2 ORF → loss of E6/E7 repression → sustained oncogene overexpression. Detectable by FISH and whole-genome sequencing.

STEP 5 : E6/E7 OVEREXPRESSION → TRANSFORMATION

E6: p53 degradation → apoptosis failure + hTERT activation → immortalisation. E7: pRb degradation → uncontrolled S-phase entry + centrosome duplication → chromosomal instability (CIN). Combined: aneuploidy and clonal expansion.

STEP 6 : CIN PROGRESSION (CIN1 → CIN2 → CIN3)

Progressive epithelial involvement. CIN3 = full-thickness dysplasia. p16INK4a IHC diffusely positive (E7 surrogate). Ki-67 throughout epithelium. ~30–40% of CIN3 progress to invasive cancer without treatment. Median progression time: 10–15 years.

STEP 7 : INVASIVE CARCINOMA

Basement membrane breached. SCC (HPV16 dominant): ~70–80% ICC. Adenocarcinoma (HPV18/45): ~20–25% ICC. EMT activation, angiogenesis, lymph node and distant metastasis. Global burden: ~600,000 new cervical cancer cases per year.

Key Molecular Targets & Diagnostic Biomarkers

Oncoproteins, Tumour Suppressors & Clinical Biomarkers

p16INK4a

Surrogate for HR-HPV E7 activity. Overexpressed when pRb is degraded. Used in CIN grading (dual stain Ki-67/p16). High specificity for CIN2+ on biopsy. IHC positive = block-diffuse staining throughout epithelium.

Ki-67

Proliferation marker. Full-thickness positivity in CIN3. Dual stain (p16+/Ki-67+) highly predictive of CIN2+ in liquid-based cytology. Distinguishes CIN from mature condyloma.

p53

Tumour suppressor degraded by E6 via E6-AP ubiquitin ligase. Wild-type p53 expression lost in HR-HPV+ cancers. p53 mutation rare in HPV+ cancers - unlike HPV-negative HNSCC (TP53 mutated in ~80%).

pRb

Retinoblastoma protein degraded by E7 (LxCxE binding). Loss of pRb → uncontrolled E2F activity → S-phase entry. Upstream of p16INK4a overexpression cascade. IHC loss correlated with advanced CIN/ICC.

hTERT

Telomerase reverse transcriptase - activated by HR-HPV E6 via TERT promoter binding. Confers cellular immortalisation by preventing telomere erosion. Telomerase activity detectable in >95% of cervical cancers.

HPV ctDNA

Circulating tumour HPV DNA - emerging liquid biopsy biomarker. HPV ctDNA in plasma correlates with tumour burden and treatment response in cervical and oropharyngeal cancers. Monitored by ddPCR or targeted NGS.

PIK3CA

Most frequently mutated oncogene in HPV+ ICC (~25–30%). Activating mutations (E545K, H1047R) activate PI3K/AKT/mTOR. Targetable by PI3K inhibitors currently in clinical trials for cervical cancer.

MYC / 8q24

MYC amplification at 8q24 is a preferred HPV integration fragile site. MYC overexpression co-operates with HPV E6/E7 in driving clonal expansion. Found in ~25% of ICC with 8q24 amplification.

Pathology & Carcinogenesis References

Jain M et al. (2023). Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape and Vaccine Evaluation for HPV-Associated Carcinogenesis. Pathogens 12(12):1380.

Wang X et al. (2024). Molecular basis of HPV carcinogenesis. Signal Transduction and Targeted Therapy 9:article.

IARC Working Group (2012). Biological agents. Volume 100B. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. IARC, Lyon.

Doorbar J et al. (2012). The biology and life-cycle of human papillomaviruses. Vaccine 30(Suppl 5):F55–F70.

zur Hausen H (2002). Papillomaviruses and cancer: from basic studies to clinical application. Nat Rev Cancer 2:342–350.

Schiffman M et al. (2010). HPV and carcinogenesis - a population-based prospective study. Cancer Res 70(8):3159–3169.

HPV Assays, Primers & Risk Classification

Clinical diagnostics, surveillance platforms, and the manufacturer discrepancy crisis in HPV genotype risk labelling

24 Validated Platforms

4 Manufacturers with Labelling Discrepancies

IARC Monograph 100B (2012) - Authoritative Standard

Primers: 8 Systems Documented

Group 1 HR: HPV16,18,31,33,35,39,45,51,52,56,58,59

Group 2A pHR: HPV68

Group 2B Possibly HR: HPV26,30,34,53,66,67,69,70,73,82,85,97

Group 3 LR: HPV6,11 + all non-alpha types

IARC Monograph 100B (2012) - The Authoritative HPV Carcinogenicity Standard

IARC 100B 2025 Classification Review

Why this matters for HPV surveillance: The IARC Monograph 100B (2012) is the only peer-reviewed, globally recognised authority for HPV carcinogenicity classification. It uses a structured evidence-weighing process evaluating epidemiological studies, animal data, and mechanistic evidence. A 2025 Microorganisms review (MDPI) reaffirmed these groupings with updated evidence. Manufacturers who deviate from IARC classifications in their package inserts directly undermine the comparability of global HPV surveillance data.

Group 1

Carcinogenic to Humans

HIGH-RISK (HR) 12 types

HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59

Evidence basis

Sufficient epidemiological evidence of cervical carcinogenesis. HPV16 + HPV18 each independently classified Group 1 (IARC, updated 2009 pre-100B). Supported by multiple meta-analyses, IARC's pooled analysis of 11,000 ICC cases (Muñoz et al., 2003), and mechanistic data (E6/E7 immortalise primary keratinocytes).

Manufacturer status: All validated primary screening assays (cobas, Abbott, BD Onclarity, HC2, APTIMA) correctly include all 12 types.

HPV59 is included in 12-type 'other HR' pools; individual detection limited to full-genotyping assays.

Group 2A

Probably Carcinogenic to Humans

PROBABLY HIGH-RISK (pHR) 1 type

HPV68

Evidence basis

HPV68 subtype ME180 confers indefinite proliferation in primary keratinocytes. Limited but suggestive epidemiological evidence from the IARC ICC studies. E6/E7 of HPV68 bind and degrade p53/pRb with lower efficiency than Group 1 types (Schiffman M et al., 2009, Infect Agents Cancer 4:8).

Manufacturer status: DISCREPANCY: Some assays include HPV68 in 'other 12 HR' pools (correct grouping but obscures its pHR distinction). Roche Linear Array labels HPV68 without clear 2A annotation. INNO-LiPA correctly documents HPV68 as Group 2A in its scientific literature.

SPF10 co-amplification: HPV68 and HPV73 produce identical amplicon sizes with SPF10 primers - confirmatory type-specific PCR required.

Group 2B

Possibly Carcinogenic to Humans

POSSIBLY HIGH-RISK (possibly HR) 12+ types

HPV26, HPV53, HPV66, HPV67, HPV69, HPV70, HPV73, HPV82 (HR-clade evidence) | HPV30, HPV34, HPV85, HPV97 (phylogenetic analogy only) | HPV5, HPV8 in EV patients (Beta genus, immunosuppressed context only)

Evidence basis

For HR-clade members (HPV26/53/66/67/70/73/82): classified based on limited epidemiological evidence plus phylogenetic membership in high-risk alpha clade. HPV53/66 occasionally found in ICC specimens; HPV70/73 detected in CIN2/3 but direct causal evidence insufficient for Group 1. For phylogenetic analogy types (HPV30/34/85/97): no direct IARC meta-analysis data; assigned by analogy. 2025 Microorganisms review (MDPI 13(5):1000) reaffirmed Group 2B status with updated molecular evidence for HPV67/70/73, noting that their E6/E7 oncoproteins show intermediate binding to p53/pRb.

Manufacturer status: MAJOR DISCREPANCY: Roche Linear Array, Seegene Anyplex 28, and HPV Direct Flow Chip variously label HPV67, HPV70, HPV73 as 'low-risk' - directly contradicting IARC 100B Group 2B status. This is the primary surveillance challenge identified by HPV researchers globally.

Group 2B ≠ Low-Risk. 'Possibly carcinogenic' means evidence is LIMITED, not ABSENT. These types must not be dismissed as LR in surveillance reports.

Group 3

Not Classifiable as Carcinogenic

LOW-RISK (LR) HPV6 + HPV11 primarily

HPV6, HPV11 (and all cutaneous non-alpha types without evidence)

Evidence basis

No evidence of carcinogenicity despite widespread infection. HPV6/11 cause condylomata acuminata (genital warts) and laryngeal/recurrent respiratory papillomatosis (RRP). E6/E7 do not efficiently degrade p53/pRb. No integration into host genome observed in benign lesions.

Manufacturer status: All manufacturers correctly classify HPV6 and HPV11 as low-risk. No discrepancy exists here.

Important: Many cutaneous genotypes (Beta, Gamma, Mu, Nu genera) are simply 'not classified' - insufficient data for any IARC group assignment.

Sources: IARC Monographs Volume 100B (2012) | Schiffman M et al. (2009) Infect Agents Cancer 4:8 | Bouvard V et al. (2009) Lancet Oncol | HPV Carcinogenicity Review, Microorganisms 2025 13(5):1000 ↗

Manufacturer Discrepancies - A Critical HPV Surveillance Problem

The surveillance impact: When researchers use full-genotyping assays (Linear Array, Anyplex 28, HPV Direct Flow Chip) and report results using manufacturer-defined risk categories, genotypes like HPV67, HPV70, HPV73 get recorded as 'low-risk' in surveillance databases - directly contradicting their IARC Group 2B classification. Over hundreds of published studies, this creates a systematically distorted global picture of 'possibly carcinogenic' HPV prevalence. It makes inter-study comparisons impossible without reanalysis and leads to underestimation of the public health burden of Group 2B types.

GENOTYPE-BY-GENOTYPE MANUFACTURER vs IARC COMPARISON:

Type	IARC 100B	Roche Linear Array	Seegene Anyplex 28	PapilloCheck	HPV Direct Flow Chip	INNO-LiPA Extra	Correct Label
HPV26	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Group 2B - documented	2B - Possibly HR
HPV53	Group 2B (HR clade)	Detected; no clear 2B annotation	Detected; no clear 2B annotation	Detected as hrHPV; no 2B annotation	Detected as hrHPV ✓ (not labelled LR)	Group 2B - documented	2B - Possibly HR
HPV66	Group 2B (HR clade)	Detected as hrHPV ✓ (not labelled LR)	Detected; no clear 2B annotation	Detected as hrHPV; no 2B annotation	Detected; risk unlabelled	Group 2B - documented	2B - Possibly HR
HPV67	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Not included	Not included	Detected; labelled LOW-RISK ⚠	Group 2B - documented	2B - Possibly HR
HPV68	Group 2A (PROBABLY carcinogenic)	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Group 2A - correctly documented	2A - Probably HR
HPV69	Group 2B (phylogenetic analogy)	Detected; labelled LOW-RISK ⚠	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Detected; labelled LOW-RISK ⚠	Detected; ambiguous	2B - Possibly HR
HPV70	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Detected as hrHPV ✓ (not labelled LR)	Labelled LOW-RISK ⚠	Detected; labelled LOW-RISK ⚠	2B - Possibly HR
HPV73	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Group 2B*; SPF10 HPV68 co-amplification	2B - Possibly HR
HPV82	Group 2B (HR clade)	Detected; ambiguous	Detected; ambiguous label	Detected as hrHPV ✓ (not labelled LR)	Detected as hrHPV ✓ (not labelled LR)	Group 2B - documented	2B - Possibly HR
HPV30	Group 2B (phylogenetic analogy)	Not included	Not included	Not included	Not included	Not included	2B - Possibly HR
HPV34	Group 2B (phylogenetic analogy)	Not included	Not included	Not included	Not included	Not included	2B - Possibly HR
HPV6	Group 3 - NOT classifiable	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	LR
HPV11	Group 3 - NOT classifiable	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	LR

ASSAY-SPECIFIC DISCREPANCY PROFILES:

Roche Linear Array (LA)

LABELLING DISCREPANCY

HPV26, HPV53, HPV66, HPV67, HPV69, HPV70, HPV73, HPV82 labelled 'low-risk' in package insert - contradicts IARC Group 2B
Cross-hybridisation: HPV52/HPV67 probes cross-react (van Ham et al., 2005)
HPV83 probe cross-reacts with HPV102; HPV84 with HPV86/HPV87/HPV114 (Godinez et al., 2019)
37-type coverage does not include HPV26/69/30/34 - Group 2B types missed
Result: surveillance studies using LA without IARC reclassification systematically undercount Group 2B types

van Ham MA et al. (2005) J Clin Microbiol; repository.ubn.ru.nl/handle/2066/49969

Seegene Anyplex II HPV28

LABELLING DISCREPANCY

HPV70 labelled 'low-risk' in package insert - contradicts IARC Group 2B
HPV67, HPV70, HPV73 included in 28-type panel but risk labels in IFU do not reflect IARC 100B Group 2B
HPV28 panel provides excellent coverage but researcher interpretation depends on accurate risk labelling
TOCE technology reduces cross-reactivity vs. LA - technical advantage undermined by labelling inaccuracy
Result: published studies using Anyplex 28 without reclassification misclassify Group 2B infections

Seegene Anyplex II HPV28 IFU; Hesselink AT et al. (2018) J Clin Microbiol

PapilloCheck HPV-Screening

PARTIAL IARC ALIGNMENT

Covers 18 hrHPV types: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73, 82
HPV70, HPV73, HPV82 correctly reported as hrHPV - does NOT mislabel them as low-risk (unlike LA/Anyplex/Direct Flow)
Does NOT distinguish IARC 2A (HPV68) from 2B within its hrHPV category - no IARC subcategory annotation
HPV67 not included in panel - Group 2B type missed entirely
Array-based hybridisation: validated in clinical settings (Pinto AP et al., PLoS ONE 2019)

Pinto AP et al. (2019) PLoS ONE 14(8):e0220373

HPV Direct Flow CHIP

LABELLING DISCREPANCY

HPV67, HPV69, HPV70 labelled 'low-risk' in package insert - contradicts IARC Group 2B
Risk annotation for Group 2B types inconsistent with IARC 100B in product documentation
35-type coverage includes many 2B types but labels them inaccurately
Limited clinical validation data vs. VALGENT-validated assays

Comar M et al. (2013) J Virol Methods 187:54-61

INNO-LiPA HPV Genotyping Extra

IARC-ALIGNED

HPV70 labelled 'low-risk' in package insert - contradicts IARC Group 2B
IARC-aligned: HPV68 correctly documented as Group 2A (probably carcinogenic)
HPV26, HPV53, HPV66, HPV70, HPV73, HPV82 documented as Group 2B in scientific IFU
Technical limitation: SPF10 produces identical amplicons for HPV68 and HPV73 - confirmatory type-specific PCR recommended
32-probe coverage with well-characterised hybridisation specificity

Fujirebio/Cosmo Bio IFU 81534; Kleter B et al. (1998) J Clin Microbiol

HPV-Risk Assay (LMNX/Self-Screen DDL)

IARC-ALIGNED

Specifically designed with IARC risk stratification built into the assay framework
54-type coverage - broadest of any commercial platform
Provides probabilistic risk scores aligned with clinical evidence rather than binary HR/LR labels
Validated in VALGENT framework; non-inferior to HC2

Hesselink AT et al. (2014) J Clin Microbiol 52:3799

How Researchers Can Rectify These Discrepancies

Always cite IARC 100B as reference standard

In all publications and surveillance reports, explicitly state risk classifications follow IARC Monograph Volume 100B (2012) - not manufacturer package inserts. Include a 'Risk Classification Note' in your methods section.

Post-hoc reclassification of raw genotype data

When using LA, Anyplex 28, Flow Chip, INNO data: reclassify HPV26→Group 2B, HPV53→Group 2B, HPV66→Group 2B, HPV67→Group 2B, HPV69→Group 2B, HPV70→Group 2B, HPV73→Group 2B, HPV82→Group 2B, HPV68→Group 2A before any analysis. Provide the reclassification table as supplementary data.

Confirmatory assay for ambiguous Group 2B types

For HPV68/HPV73 (identical SPF10 amplicons): use type-specific PCR or E7 gene sequencing for confirmation. For HPV70 detected by LA: confirm with NGS or type-specific PCR in high-burden samples.

Engage manufacturers via formal channels

Researchers and clinicians can formally request that Roche, Seegene, and Master Diagnostica update IFUs to align with IARC 100B. Letters to manufacturers cc'd to IARC, WHO-PAHO, and IPVS create audit trails for regulatory updates.

Use IARC-aligned assays when possible for surveillance

INNO-LiPA HPV Genotyping Extra and HPV-Risk Assay (LMNX) have the most accurate IARC-aligned labelling among full-genotyping platforms. Recommend these for surveillance studies where Group 2B classification matters.

Advocate for regulatory update of IFU requirements

CE-IVD and FDA 510(k) frameworks should require alignment with IARC 100B for risk-category labelling. Professional societies (IPVS, EUROGIN, ASCCP) can petition regulatory bodies (EMA, FDA) to mandate this through position statements.

Key publications on assay discrepancies:
• van Ham MA et al. (2005) J Clin Microbiol - Cross-hybridisation in Roche Linear Array; HPV52/67 probe issues. PDF ↗
• Comar M et al. (2013) J Virol Methods 187:54-61 - HPV Direct Flow Chip vs INNO-LiPA discordance for HPV66/67/70/73. Full text ↗
• Godinez JM et al. (2019) Diagn Pathol 14:35 - Roche LA cross-hybridisation for HPV83/84/102/86/87/114 probes.
• Arbyn M et al. (2015) J Clin Virol 76:S14 - VALGENT clinical validation framework for HPV assays.
• Bouvard V et al. (2009) Lancet Oncol 10:321-322 - IARC Group 2B evidence review for possibly carcinogenic HPVs.
• Fujirebio IFU 81534 (2016) - INNO-LiPA HPV Genotyping Extra package insert with IARC-aligned risk annotations. PDF ↗

24 Validated HPV Assay Platforms - Full Comparison Table

⚠ DISCREPANCY ✓ IARC-Aligned ~ Partial

Clinical validation standard (Meijer criteria, 2009 / VALGENT framework): An HPV test for cervical cancer primary screening must achieve: sensitivity ≥90% for CIN2+ vs. colposcopy, specificity within 2% of HC2, ≥85% intra-laboratory and ≥75% inter-laboratory κ for reproducibility. Second-generation comparators: cobas 4800, Abbott RealTime, BD Onclarity, Anyplex II (Arbyn et al., 2015). The IARC Risk Label column flags which assays have labelling discrepancies for Group 2B types. References: Arbyn M et al. 2021 CMI ↗ | IHRC Genotyping Technical Report 2022 ↗

PCR Primer Systems - Complete Sequences, Targets & Applications

Critical primer limitation: No single PCR primer set detects all 5 human PV genera (Alpha, Beta, Gamma, Mu, Nu) reliably. GP5+/GP6+ and MY09/MY11 target Alpha-HPV L1 only. FAP59/FAP64 targets Beta-HPV only. Gamma/Mu/Nu types require metagenomic approaches or broad-spectrum degenerate CpI/CPIIG primers. SPF10 (65 bp) is optimal for degraded FFPE DNA but produces identical amplicons for HPV68/HPV73.

Primer System	Primer Name	Sequence 5'→3'	Target	Amplicon	Types Detected	Application	Reference
GP5+/GP6+	GP5+	TTTGTTACTGTGGTAGATACTAC	L1	150 bp	~40 HPV genotypes	Gold standard for screening/research; used in POBASCAM, VALGENT trials	de Roda Husman et al. (1995) JGV
GP5+/GP6+	GP6+	GAAAAATAAACTGTAAATCATATTC	L1	-	-	-	-
MY09/MY11	MY09	CGICCIGGIBOWICCITARTCWGG	L1	450 bp	~30 mucosal HPV	Clinical & research genotyping; basis of HC2 probe design	Manos et al. (1989)
MY09/MY11	MY11	GCMCAGGGWCATAAYAATGG	L1	-	-	-	-
PGMY09/PGMY11	PGMY09	GCMCAGGGWCATAAYAATGG (degenerate mix of 9)	L1	450 bp	>40 genotypes	Linear Array assay; research genotyping; FDA-cleared as lab test	Gravitt et al. (2000) JCM
PGMY09/PGMY11	PGMY11	TTTGTTACTGTGGTAGATACTAC (degenerate mix of 13)	L1	-	-	-	-
SPF10	SPF1c	CCTTGTTRCAYGGGGCNGT	L1	65 bp	Wide spectrum	Research; high sensitivity short amplicon for FFPE	Kleter et al. (1998) JCM
SPF10	SPF2	GCAAGTGTGATCTACTTGGCTG	L1	-	-	-	-
FAP59/FAP64	FAP59	TAACWGTIGGICAYCCWTATT	L1	480 bp	Cutaneous Beta-HPVs	Beta-HPV detection in dermatological studies; EV research	Favre et al. (2000)
FAP59/FAP64	FAP64	CCWATATCWVHCATITCICCATC	L1	-	-	-	-
CPI/CPIIG	CP-I	TTTTGTGGCCDTGCTATCT	L1	459 bp	Broad spectrum (skin/mucosal)	Broad spectrum; research and clinical	Coutlee et al. (2002)
CPI/CPIIG	CP-II+G	GAAAAATAAACTGTAAATCATATTC	L1	-	-	-	-
E7-F/E7-R (HPV16)	E7-F	ATGAAATAGATGGTCCAGC	E7	~400 bp	HPV16 specific	Quantification/sequencing of HPV16 E7	Type-specific refs
E7-F/E7-R (HPV16)	E7-R	TGGTTTCTGAGAACAGATGG	E7	-	-	-	-
E6-sense/E6-antisense (HPV16)	E6-sense	ATGCACCAAAAGAGAACTGCAATG	E6	~200 bp	HPV16 specific	Type-specific PCR for HPV16	Yamada et al. (1995)
E6-sense/E6-antisense (HPV16)	E6-antisense	CTTCTGGCTTCTGCCATGTTTCA	E6	-	-	-	-
E6-F/E6-R (HPV18)	HPV18 E6-F	ATGCACCTAAAGAAACTGCAATG	E6	~200 bp	HPV18 specific	Type-specific PCR for HPV18	Muñoz N et al. (2003) NEJM
E6-F/E6-R (HPV18)	HPV18 E6-R	GTACAGCTGGGAATCTGTGTT	E6	-	-	-	-
HPVE7F/HPVE7R (HPV18)	HPV18 E7-F	ATGCATGGAGATACACCTACATTG	E7	~300 bp	HPV18 specific	HPV18 E7 detection	Multiple refs
HPVE7F/HPVE7R (HPV18)	HPV18 E7-R	AACAAATGGTCCAGCTGGCTTTTG	E7	-	-	-	-
LCR-F/LCR-R (HPV16 lineage)	LCR-F	GGGCAGTGGTGGAATGCAAATAGA	LCR/E6	~580 bp	HPV16 lineage typing	HPV16 variant classification/lineage typing	Yamada T et al. HPV lineage papers
LCR-F/LCR-R (HPV16 lineage)	LCR-R	CCTATAAATCCTGATGCTGATAAATAG	LCR/E6	-	-	-	-
INNO-LiPA SPF10	SPF1c-biotin	CCTTGTTRCAYGGGGCNGT	L1	65 bp	Wide spectrum (INNO-LiPA)	INNO-LiPA HPV Genotyping Extra assay	Van Doorn LJ et al. (2001)
INNO-LiPA SPF10	SPF2-biotin	GCAAGTGTGATCTACTTGGCTG	L1	-	-	-	-
Micalessi RIATOL (HPV16 E7)	HPV16E7-FP	AGCTCAGAGGAGGAGGATGAA	E7	~110 bp	HPV16 specific	RIATOL in-house qPCR: 17-type panel, high-throughput LBC screening (700 samples/24h)	Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661
Micalessi RIATOL (HPV16 E7)	HPV16E7-RP	GGTTACAATATTGTAATGGGCTC	E7	-	-	-	-
Micalessi RIATOL (HPV18 E7)	HPV18-153F	CCGACGAGCCGAACCA	E7	~66 bp	HPV18 specific	RIATOL in-house qPCR: HPV18 E7 quantification + viral load	Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661
Micalessi RIATOL (HPV18 E7)	HPV18-219R	CTCAATTCTGGCTTCACACTTACAA	E7	-	-	-	-
Micalessi RIATOL (HPV31 E6)	HPV31E6-FP	ACGATTCCACAACATAGGAGGA	E6	~120 bp	HPV31 specific	RIATOL in-house qPCR: HPV31 E6 quantification + viral load	Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661
Micalessi RIATOL (HPV31 E6)	HPV31E6-RP	TACACTTGGGTTTCAGTACGAGGT	E6	-	-	-	-
Micalessi RIATOL (HPV45 E7)	HPV45-161F	CGTCGGGCTGGTAGTTGTG	E7	~125 bp	HPV45 specific	RIATOL in-house qPCR: HPV45 E7 quantification + viral load	Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661
Micalessi RIATOL (HPV45 E7)	HPV45-286R	ATTGCATTTGGAACCTCAGAATG	E7	-	-	-	-
Micalessi RIATOL (HPV51 E7)	HPV51 358 F	AAAGCAAAAATTGGTGGACGA	E7	~80 bp	HPV51 specific	RIATOL in-house qPCR: HPV51 E7 quantification + viral load	Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661
Micalessi RIATOL (HPV51 E7)	HPV51 438 R	TGCCAGCAATTAGCGCATT	E7	-	-	-	-

DNA vs. RNA-Based Assays - Clinical Implications for HPV Surveillance

DNA-Based Assays

Target: L1 ORF, E6/E7, E1 genomic DNA
Detect HPV regardless of transcriptional activity (latent + active infections)
May detect clinically irrelevant transient or cleared infections
Examples: HC2, cobas, Linear Array, INNO-LiPA, Anyplex 28, Allplex 28
Higher sensitivity; lower specificity for clinically active transforming infection
Risk classification applies at genotype level - requires IARC 100B reference
VALGENT-validated DNA tests: cobas, Abbott RealTime, BD Onclarity, HC2, APTIMA, Anyplex II

RNA-Based Assays (mRNA)

Target: E6/E7 mRNA - active oncogenic transcription only
Indicates clinically active, potentially transforming infection
Higher specificity; better positive predictive value (PPV) for CIN2+
Example: APTIMA HPV (Hologic) - TMA method; FDA-approved
Slightly lower sensitivity than DNA assays; may miss early infections
IARC risk classification still applies - mRNA detection of Group 2B types still requires correct labelling
Less suitable for broad-spectrum surveillance due to lower sensitivity for non-transforming types

HPV DNA/RNA Assays - Validated Diagnostic Platforms

Clinically validated, FDA-approved, and CE-IVD HPV DNA/RNA molecular assays evaluated against IARC 100B classifications.

2023 Global HPV Test Market - A Critical Validation Gap

264+

Distinct commercial HPV tests globally

511+

Test variants available worldwide

~21%

Meet international validation criteria

50%

Have zero peer-reviewed publications

79%

Lack analytical / clinical performance evidence

86 / 76

New tests introduced / withdrawn 2020–2023

Validation imperative: Only HPV assays clinically validated per international guidelines (Meijer et al., 2009; Arbyn et al., 2020) and/or approved by regulatory authorities (FDA 510(k)/PMA, CE-IVD) should be used for primary cervical cancer screening. The vast majority of commercially available tests have NOT been adequately validated.

Source: Poljak M et al. (2024) J Clin Virol 172:105671.

Validated & Approved Assays - Click Any Test to Expand Full Details

▼ Click any assay row to reveal technology details, IARC 100B alignment, and limitations

FDA-APPROVED - PRIMARY CERVICAL SCREENING (USA)

Hybrid Capture 2 (HC2)

Qiagen / DiASorin | Signal amplification (RNA:DNA hybrid capture)

🇺🇸 FDA CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

L1/E6/E7 RNA probe cocktail

Types Detected

13 HR types pooled: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68

Sensitivity (CIN2+)

~90–97%

Specificity (CIN2+)

~86–91%

Genotype Reporting

Pooled HR positive / negative - no individual genotyping

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV68 (in probe set)

Group 2B omitted from panel: HPV26, 53, 66, 67, 70, 73, 82 - not covered

Known Limitations

No individual genotype output - cannot distinguish HPV16/18 without reflex testing
Cross-reactivity: probe cocktail may react with low-risk types
FDA-cleared for clinician-collected specimens only
HPV66 (Group 2B) absent from probe set despite widespread clinical use

HC2 FDA 2003; Lorincz AT et al. (2004) J Clin Microbiol

Cobas HPV 4800 / 6800 / 8800

Roche Molecular Diagnostics | Real-time PCR (dual fluorescence channels)

🇺🇸 FDA CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

L1 ORF divergent regions - type-specific probes

Types Detected

14 HR: HPV16 (individual) + HPV18 (individual) + 12 pooled (31,33,35,39,45,51,52,56,58,59,66,68)

Sensitivity (CIN2+)

~94–96%

Specificity (CIN2+)

~88–92%

Genotype Reporting

HPV16 individual | HPV18 individual | 12 other HR pooled

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66 (in other-HR pool)

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

12 HR types reported as pooled 'other HR' - no individual results for HPV31, 33, 35 etc.
HPV66 (Group 2B) included in pool but not annotated as IARC 2B in IFU
FDA-cleared for ThinPrep LBC medium only
Higher cost vs. signal-amplification assays

Heideman DA et al. (2011) J Clin Microbiol 49:3679

Aptima HPV (AHPV) / Aptima HPV 16 18/45 Genotype

Hologic | Transcription-Mediated Amplification (TMA) - targets E6/E7 mRNA

🇺🇸 FDA CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

E6/E7 mRNA (transcriptionally active infections only)

Types Detected

14 HR types: same as Cobas - mRNA targets, not DNA

Sensitivity (CIN2+)

~91–95%

Specificity (CIN2+)

~92–95% (highest specificity among FDA-approved)

Genotype Reporting

Pooled 14 HR; reflex genotype assay: HPV16 individual / HPV18/45 pool

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66 (in pool)

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

Detects mRNA only - may miss latent / transcriptionally silent infections
Higher specificity = slightly lower sensitivity vs. DNA assays
Requires Panther instrument - fully platform-locked
HPV45 pooled with HPV18 in reflex assay - adenocarcinoma types not individually resolved

Ratnam S et al. (2011) J Clin Microbiol 49:3308

BD Onclarity HPV Assay

Becton Dickinson (BD) | Real-time PCR - extended genotyping pool design

🇺🇸 FDA CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

E6/E7 region (5 fluorescent channels with type pools)

Types Detected

14 HR: HPV16 | HPV18 | HPV45 | HPV31 | HPV51 | HPV52 | HPV33/58 pool | HPV56/59/66 pool | HPV35/39/68 pool

Sensitivity (CIN2+)

~93–96%

Specificity (CIN2+)

~87–91%

Genotype Reporting

7 individual / pool outputs; HPV18 and HPV45 individually distinguished

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66 (in HPV56/59/66 pool)

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

HPV33/58 reported as a pool - cannot distinguish two Group 1 types individually
HPV68 (Group 2A) pooled with HPV35/39 - no individual 2A annotation for triage
HPV66 (Group 2B) pooled with HPV56/59 - Group 2B burden not separately assessable
Requires BD Viper LT or BD COR instrument - platform-locked

Iftner T et al. (2019) J Clin Microbiol 57:e00299

Abbott RealTime hrHPV / Alinity m HPV

Abbott Molecular | Real-time PCR (L1 type-specific fluorescent probes)

🇺🇸 FDA CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

L1 ORF - type-specific probes + internal control

Types Detected

14 HR: HPV16 (individual) + HPV18 (individual) + HPV45 (individual) + Group A (31,33,52,58) + Group B (35,39,51,56,59,66,68)

Sensitivity (CIN2+)

~93–97%

Specificity (CIN2+)

~88–92%

Genotype Reporting

HPV16 individual | HPV18 individual | HPV45 individual | Group A (31,33,52,58) | Group B (35,39,51,56,59,66,68)

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66 (in Group B pool)

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

11 types in two pooled channels - no individual genotyping beyond HPV16/18/45
HPV66 (Group 2B) in Group B pool without IARC 2B annotation
Requires m2000 or Alinity m platform - platform-locked

FDA P230003 (Alinity m HR HPV); Cuschieri K et al. (2016) J Clin Virol 76(S1):S27

Cervista HPV HR / Cervista HPV 16/18

Hologic | Invader (cleavase) signal amplification

🇺🇸 FDA CE-IVD IARC: PARTIAL

▼ expand

Target Region

L1 ORF - invader probes, 3-colour fluorescence

Types Detected

14 HR types: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68

Sensitivity (CIN2+)

~90–94%

Specificity (CIN2+)

~85–90%

Genotype Reporting

Pooled HR result; reflex HPV16/18 genotype assay available separately

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

No individual genotyping from single run - requires separate Cervista GT assay for HPV16/18
Invader chemistry more complex than PCR workflows
Limited VALGENT framework validation data vs. Cobas/HC2

Dockter J et al. (2009) J Clin Virol 45(S1):S55

Xpert HPV (GeneXpert)

Cepheid | Sealed cartridge real-time PCR (NAAT)

CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

E6/E7 region distributed across 5 fluorescent channels

Types Detected

14 HR: HPV16 | HPV18/45 pool | HPV31/33/35/52/58 pool | HPV51/59 pool | HPV39/56/66/68 pool

Sensitivity (CIN2+)

~92–96%

Specificity (CIN2+)

~87–91%

Genotype Reporting

HPV16 individual | HPV18/45 pool | 3 further channel pools

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66 (in pool)

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

HPV45 pooled with HPV18 - adenocarcinoma-associated types not individually resolved
HPV68 (Group 2A) pooled with HPV35/39/66 - no individual 2A annotation
Cartridge format: higher per-test cost vs. batch PCR
Not FDA-approved for primary cervical screening in USA

Cepheid Xpert HPV IFU (301-2585 Rev C); Bonde J et al. (2014) J Clin Microbiol 52:4406

IN-HOUSE & RESEARCH-GRADE ASSAYS - PUBLISHED & CLINICALLY DEPLOYED

RIATOL Type-Specific qPCR (Micalessi et al., 2012)

RIATOL / Sonic Healthcare Benelux - Univ. Antwerp | TaqMan-based multiplex qPCR - 7 multiplex reactions (384-well, LightCycler 480)

IARC: PARTIAL

▼ expand

Target Region

E6/E7 oncogenes (type-specific) + β-globin internal control - targets always intact regardless of viral integration

Types Detected

17 types individually: 12 Group 1 HR (HPV16,18,31,33,35,39,45,51,52,56,58,59) + HPV68 (2A) + HPV53,66 (2B) + HPV6 (LR) + HPV67 (undetermined)

Sensitivity (CIN2+)

~95.4–98.3%

Specificity (CIN2+)

~76–85%

Genotype Reporting

Full individual genotyping for all 17 types including viral load (copies/cell) per type

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV53, HPV66, HPV67

Group 2B omitted from panel: HPV26, 70, 73, 82 - not covered

Known Limitations

In-house assay - requires laboratory-specific validation and optimisation before adoption
Not FDA-approved or CE-IVD marked; not in VALGENT framework
Requires JANUS Automated Workstation (Perkin-Elmer) and LightCycler 480 for high-throughput workflow
HPV67 (undetermined risk) and HPV53/66 (Group 2B) included - IFU risk labelling not applicable as in-house
Throughput of 700 LBC samples in <24 h validated only at originating institution (RIATOL, Antwerp)

Micalessi IM et al. (2012) Clin Chem Lab Med 50(4):655-661. DOI: 10.1515/CCLM.2011.835

VALGENT-VALIDATED / WHO-PREQUALIFIED / CE-IVD - EUROPE & LOW-RESOURCE SETTINGS

careHPV

Qiagen | Signal amplification - simplified HC2 for point-of-care

CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

L1/E6/E7 probe cocktail (same hybridisation principle as HC2)

Types Detected

14 HR types: pooled positive / negative result only

Sensitivity (CIN2+)

~88–93%

Specificity (CIN2+)

~84–88%

Genotype Reporting

Single pooled HR positive / negative - no genotyping

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

None individually labelled

Group 2B omitted from panel: HPV26, 53, 66, 67, 70, 73, 82 - not covered

Known Limitations

No genotyping capability whatsoever
Lower sensitivity than laboratory-grade assays in some populations
Requires dedicated careHPV instrument

Qiao YL et al. (2008) Lancet Oncol 9:929; WHO prequalification

EuroArray HPV

DiaSorin / EuroImmun | Multiplex PCR + microarray hybridisation

CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

L1 ORF - 15-probe capture array

Types Detected

15 HR types individually: all 12 Group 1 + HPV53 (2B) + HPV66 (2B) + HPV68 (2A)

Sensitivity (CIN2+)

~92–95%

Specificity (CIN2+)

~88–93%

Genotype Reporting

Full individual genotyping for all 15 types

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV53, HPV66

Group 2B omitted from panel: HPV26, 67, 70, 73, 82 - not covered

Known Limitations

Array-based workflow - longer turnaround vs. real-time PCR
HPV53/66 (Group 2B) included but IFU may not explicitly annotate IARC 2B subcategory
Not FDA-approved

Depuydt CE et al. (2011) J Clin Microbiol 49:1454

Anyplex II HPV HR Detection

Seegene | Multiplex real-time PCR (TOCE technology)

CE-IVD VALGENT IARC: PARTIAL

▼ expand

Target Region

E6/E7 region - Tagging Oligonucleotide Cleavage and Extension probes

Types Detected

14 HR types individually: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68

Sensitivity (CIN2+)

~92–95%

Specificity (CIN2+)

~86–91%

Genotype Reporting

Individual genotype result for all 14 types

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66

Group 2B omitted from panel: HPV26, 53, 67, 70, 73, 82 - not covered

Known Limitations

HPV66 (Group 2B) detected but IFU does not explicitly annotate as IARC Group 2B
Not FDA-approved for primary screening in USA

Bonde J et al. (2018) J Clin Virol 108:64 (VALGENT-4)

HPV-Risk Assay (Self-Screen B.V. / DDL)

Self-Screen / DDL Diagnostic Laboratory | Real-time PCR - E7 region with IARC risk stratification built in

CE-IVD VALGENT IARC: YES

▼ expand

Target Region

E7 ORF - 15 types; probabilistic IARC risk score output

Types Detected

15 types: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 67, 68 (includes HPV67 - Group 2B)

Sensitivity (CIN2+)

~93–96%

Specificity (CIN2+)

~91–95%

Genotype Reporting

Probabilistic IARC risk score; partial individual genotyping

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV66, HPV67

Group 2B omitted from panel: HPV26, 53, 70, 73, 82 - not covered

Known Limitations

Not FDA-approved; CE-IVD and VALGENT-validated only
Still omits HPV26, 53, 70, 73, 82 from Group 2B
Requires DDL laboratory infrastructure

Hesselink AT et al. (2014) J Clin Microbiol 52:3799

PapilloCheck HPV-Screening

Greiner Bio-One | PCR + DNA microarray hybridisation (E1-region probes)

CE-IVD IARC: PARTIAL

▼ expand

Target Region

E1 ORF - 24 genotype-specific capture probes on oligonucleotide array

Types Detected

24 types: 18 hrHPV (HPV16,18,31,33,35,39,45,51,52,53,56,58,59,66,68,70,73,82) + 6 lrHPV (6,11,40,42,43,44/55)

Sensitivity (CIN2+)

~90–96%

Specificity (CIN2+)

~87–92%

Genotype Reporting

Full individual genotyping for all 24 types

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV53, HPV66, HPV70, HPV73, HPV82

Group 2B omitted from panel: HPV26, HPV67 - not covered

Known Limitations

HPV67 (Group 2B) absent from panel despite broad coverage
Group 2B types detected but IARC subcategory not annotated in IFU
Array workflow: more complex and longer turnaround vs. real-time PCR
Not validated in VALGENT framework; not FDA-approved

Pinto AP et al. (2019) PLoS ONE 14(8):e0220373

INNO-LiPA HPV Genotyping Extra

Fujirebio | PCR (SPF10) + reverse hybridisation on nitrocellulose strip (LiPA)

CE-IVD IARC: YES

▼ expand

Target Region

L1 region (SPF10 65 bp amplicon) + 32 genotype-specific probes on strip

Types Detected

32 types individually: all 12 Group 1 HR + HPV68 (2A) + HPV26,53,66,70,73,82 (2B) + LR/unclassified types

Sensitivity (CIN2+)

~92–96%

Specificity (CIN2+)

~88–93%

Genotype Reporting

Full individual genotyping for all 32 types; IARC 2B annotated in scientific IFU

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV26, HPV53, HPV66, HPV70, HPV73, HPV82

Group 2B omitted from panel: HPV67 - not on strip

Known Limitations

SPF10 produces identical amplicons for HPV68 and HPV73 - confirmatory type-specific PCR required
Manual strip-reading workflow - lower throughput than automated platforms
Not FDA-approved; CE-IVD only
Not formally in VALGENT framework

Fujirebio IFU 81534; Kleter B et al. (1998) J Clin Microbiol

Anyplex II HPV28

Seegene | Multiplex real-time PCR (TOCE technology) - 28-type panel

CE-IVD IARC: PARTIAL

▼ expand

Target Region

E6/E7 region - 28 individual type-specific TOCE probes

Types Detected

28 types individually: all 12 Group 1 HR + HPV68(2A) + HPV26,53,66,67,70,73,82(2B) + 7 LR/other

Sensitivity (CIN2+)

~93–96%

Specificity (CIN2+)

~87–92%

Genotype Reporting

Full individual genotyping for all 28 types

IARC 100B Alignment

Group 1 (12 HR):

✓ YES

HPV68 (Group 2A):

✓ YES

Gr.2B in panel:

HPV26, HPV53, HPV66, HPV67, HPV70, HPV73, HPV82

Group 2B omitted from panel: None - broadest Group 2B coverage of any commercial assay

Known Limitations

IFU risk labelling does not explicitly annotate HPV67/70/73/82 as IARC Group 2B - key discrepancy
Researcher use without IARC reclassification leads to systematic Group 2B misclassification in surveillance
Not FDA-approved; not in VALGENT framework

Seegene Anyplex II HPV28 IFU; Hesselink AT et al. (2018) J Clin Microbiol

Table 1: Validated HPV Assays - IARC 100B Alignment at a Glance

Sources: HPV World (2020); Shi L et al. (2025) Front Cell Infect Microbiol 15:1681779; Arbyn M et al. (2020)

Assay	Manufacturer	Method	Types	Genotyping	IARC Gr.1 ✓	HPV68 (2A)	Gr.2B Covered	FDA	CE / VALGENT
Hybrid Capture 2	Qiagen/DiASorin	Signal ampl.	13 HR (pooled)	None	✓	✓ 2A	HPV68 only	YES (2003)	CE / VALGENT
Cobas HPV 4800	Roche	qPCR	14 HR	HPV16 + HPV18 indiv.	✓	✓ 2A	HPV66	YES (2011)	CE / VALGENT
Aptima HPV	Hologic	TMA (mRNA)	14 HR	HPV16/18/45 reflex	✓	✓ 2A	HPV66	YES (2011)	CE / VALGENT
BD Onclarity	Becton Dickinson	qPCR (extended)	14 HR	7 pool groups	✓	✓ 2A	HPV66 (pooled)	YES (2012)	CE / VALGENT
Abbott RealTime hrHPV	Abbott	qPCR	14 HR	HPV16 + HPV18 + HPV45 indiv.; Group A+B pools	✓	✓ 2A	HPV66	YES (2010)	CE / VALGENT
Cervista HPV HR	Hologic	Invader cleavase	14 HR	Pooled; HPV16/18 reflex	✓	✓ 2A	HPV66	YES (2009)	CE / partial
Xpert HPV	Cepheid	Cartridge qPCR	14 HR	HPV16 + HPV18/45 pool	✓	✓ 2A	HPV66 (pooled)	-	CE / VALGENT / WHO-PQ
careHPV	Qiagen	Signal ampl.	14 HR	None - pooled only	✓	✓ 2A	None	-	CE / VALGENT / WHO-PQ
EuroArray HPV	DiaSorin	PCR + array	15 HR	Full indiv. (15)	✓	✓ 2A	HPV53, HPV66	-	CE / VALGENT
Anyplex II HPV HR	Seegene	TOCE qPCR	14 HR	Full indiv. (14)	✓	✓ 2A	HPV66	-	CE / VALGENT
HPV-Risk Assay	Self-Screen/DDL	qPCR + IARC score	15 HR/pHR	Partial + risk score	✓	✓ 2A	HPV66, HPV67	-	CE / VALGENT
PapilloCheck	Greiner Bio-One	PCR + array	24 (18HR+6LR)	Full indiv. (24)	✓	✓ 2A	HPV53,66,70,73,82	-	CE only
INNO-LiPA Extra	Fujirebio	PCR + LiPA strip	32 types	Full indiv. (32)	✓	✓ 2A	HPV26,53,66,70,73,82 ✓2B	-	CE only
Anyplex II HPV28	Seegene	TOCE qPCR	28 types	Full indiv. (28)	✓	✓ 2A	HPV26,53,66,67,70,73,82	-	CE only

IARC Group 1 (12 types): HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 | Group 2A: HPV68 | Group 2B (HR clade): HPV26, 53, 66, 67, 70, 73, 82
No FDA-approved assay currently covers all Group 2B HR-clade types. IARC alignment refers to risk labelling in the product IFU. 'Gr.2B Covered' = Group 2B types included in the assay's detection panel.

Table 2: HPV Detection Technology Categories - Advantages & Critical Challenges

Source: Shi L et al. (2025) Front Cell Infect Microbiol 15:1681779, Table 1

Clinically Established Assays

Method / Assay	Technology	Advantages	Critical Challenges
HC2	Signal amplification	Higher sensitivity & reliability; mass screening capable	No subtype differentiation; cross-reactivity with LR types
Cervista	Invader cleavase	Low sample requirements; built-in internal controls	Cannot distinguish subtypes without reflex assay
Cobas HPV 4800	Real-time PCR	High sensitivity; HPV16/18 individual reporting; clinically validated	High cost; false positive risk; ThinPrep LBC only
BD Onclarity	Real-time PCR (ext. pools)	High sensitivity; extended genotyping groups; HPV45 distinguished	Types in pools; Group 2B not annotated in reporting
PapilloCheck	PCR + microarray	High sensitivity; 24-type coverage; viral load quantification	False positive risk; complex array workflow; high cost
Aptima HPV	TMA - mRNA target	Highest specificity; reflects active viral transcription	Misses latent infections; reflex required for typing
Abbott RealTime	Real-time PCR	High sensitivity; HPV16/18 individual; automated workflow	No broader genotyping; platform-locked

PCR-Based Research Assays

Method / Assay	Technology	Advantages	Critical Challenges
GP5+/GP6+	Consensus PCR (~150 bp)	Gold standard for research; broad Alpha-HPV detection	Not FDA-approved; requires downstream genotyping
MY09/MY11	Degenerate consensus (~450 bp)	Wide type coverage; basis of PGMY system	Lower sensitivity in LBC vs. short amplicon systems
PGMY09/11	Pooled degenerate primers	37-type coverage; basis for Roche Linear Array	Requires downstream genotyping; not standalone
SPF10	Ultra-short PCR (65 bp)	Optimal for degraded FFPE DNA; high sensitivity	HPV68/HPV73 co-amplification issue with INNO-LiPA

Emerging Technologies

Method / Assay	Technology	Advantages	Critical Challenges
ddPCR	Droplet Digital PCR	Absolute HPV DNA quantification; ~100x more sensitive; ctDNA detection	High cost; no FDA-cleared application yet
NGS	Next-Generation Sequencing	Full genome typing; all types; integration sites; lineage assignment	Expensive; complex bioinformatics; over-sensitive for screening
CRISPR-Cas12/13	CRISPR-based detection	Ultra-high specificity; single-nucleotide discrimination; visual POC readout	Mostly proof-of-concept; multiplexing challenging
LAMP	Loop-mediated isothermal ampl.	No thermal cycler; rapid (30–60 min); low cost; cold-chain tolerant	Complex primer design; contamination risk; limited multiplexing
AI-assisted	Machine learning integration	Automated typing; risk stratification; cytology pattern recognition	Large training data required; regulatory approval pending

Table 3: Sampling Approaches & Compatible HPV Detection Platforms

Source: Shi L et al. (2025) Front Cell Infect Microbiol 15:1681779, Table 2

Sample Type	Collection Method	Compatible Assays	Clinical Applicability	Key Limitation
Clinician-collected cervical	LBC (SurePath or ThinPrep)	HC2, Cobas, APTIMA, BD Onclarity, Abbott, Cervista, Xpert, careHPV, EuroArray, Anyplex	FDA-approved gold standard; mandatory for regulatory approval	Invasive; requires speculum exam; limited access in low-resource settings
Self-collected vaginal swab	Dry swab or lavage; home / clinic-assisted	Validated PCR assays - VALGENT-validated for self-sampling: Cobas, Anyplex HR, EuroArray, careHPV	Non-inferior to clinician-collected for HR-HPV detection; improves screening uptake	Not FDA-approved for primary indication; collection site variability
Urine (first-void)	Self-collected; non-invasive	Research PCR-based assays; ddPCR; LAMP	Fully non-invasive; hard-to-reach populations; high acceptability	Lower sensitivity (~70–85%) vs. cervical samples; concentration optimisation required
Oral / oropharyngeal swab	Gargle-rinse or swab; self-collected	Type-specific PCR (HPV16); research assays	Oropharyngeal cancer surveillance; research use	No validated clinical assay; low viral loads
Blood / plasma (liquid biopsy)	Venous blood; cell-free DNA extraction	ddPCR, NGS (HPV ctDNA / HPV-seq)	Post-treatment monitoring of HPV-associated cancers	Detects ctDNA only in active cancer; not for primary cervical screening
Extracellular vesicles (EVs)	EV isolation from blood / urine	Emerging: ddPCR, NGS from EV-derived nucleic acids	Research; non-invasive HPV oncogene biomarker detection	Highly experimental; no validated clinical assay; complex EV isolation
FFPE tissue	Biopsy or surgical excision	SPF10 + INNO-LiPA, GP5+/6+, NGS, type-specific PCR	Post-biopsy genotyping; lineage / integration site analysis	DNA degradation limits sensitivity; retrospective use only
FTA / dry media card	Self-collected swab transferred to FTA card	HPVIR; PCR-based validated assays (Uppsala protocol)	Room-temperature transport; no cold chain; LMIC-suitable	Requires punch-processing equipment; limited assay compatibility

Table 4: Isothermal Amplification Techniques vs. Conventional PCR

Source: Shi L et al. (2025) Front Cell Infect Microbiol 15:1681779, Table 4 | Rohatensky (2018); Zhang (2020); Liu (2024)

Technique	Type	Temp.	Time	Equipment	HPV Types	Validation	Advantages	Limitations
Conventional PCR	Thermocycling	55–95°C	2–4 h	Thermal cycler + gel	All types (consensus/type-specific)	Extensive - VALGENT, FDA	Reference standard; broad coverage; established workflow	Carry-over risk; thermal cycler required; longer run
Real-time qPCR	Thermocycling	55–95°C	2–3 h	qPCR instrument	14–28 HR types (commercial)	Extensive - FDA-approved	Quantitative; rapid; closed-tube; low contamination risk	Platform-locked; high instrument cost
ddPCR	Droplet digital PCR	55–95°C	3–5 h	ddPCR + droplet generator	HPV16, 18; type-specific panels	Limited - emerging clinical	Absolute quantification; 100× more sensitive; ctDNA	Expensive; no FDA HPV application; complex analysis
LAMP	Loop-mediated isothermal	60–65°C	30–60 min	Heat block / water bath	HPV16, 18 primarily	Limited - proof-of-concept	No thermal cycler; rapid; low cost; visual readout; cold-chain tolerant	Complex primer design; contamination risk; limited multiplexing
RPA / NASBA	Recombinase polymerase	37–42°C	15–30 min	Minimal; POC-compatible	HPV16, 18 primarily	Research only	Ultra-rapid; near body temp; lateral flow compatible	Very limited HPV type coverage; no validated commercial assay
CRISPR-Cas12a	CRISPR + LAMP pre-amp	37–42°C	~60 min	Fluorescent reader or LF	HPV16, 18; research panels	Proof-of-concept only	Ultra-high specificity; single-nt discrimination; visual POC readout	Requires pre-amplification; multiplexing challenging; no clinical validation

2023 Global HPV Test Inventory - Key Findings & Recommendations

Poljak M, Oštrbenk Valenčak A, Cuschieri K, Bohinc KB, Arbyn M. J Clin Virol. 2024;172:105671

Critical finding: Despite 264+ commercial HPV tests available globally, only ~21% meet international validation criteria (Meijer/Arbyn guidelines). Evidence of analytical or clinical performance is lacking for 79% of all HPV tests, and 50% have zero peer-reviewed publications. This represents a major public health risk.

Validation gap

Only ~21% of 264+ commercial HPV tests meet international clinical validation criteria (Meijer 2009 / Arbyn 2020). The remaining 79% are unvalidated for primary cervical cancer screening.

Publication gap

50% of distinct commercial HPV tests have zero peer-reviewed publications. No independent published evidence of performance for half of all tests currently sold globally.

Market dynamics 2020–2023

86 new tests introduced and 76 withdrawn. Strong commercial activity but without consistently adequate quality standards underpinning new market entrants.

Geographic distribution

Majority of unvalidated tests concentrated in Asia-Pacific and emerging markets. North America and Europe have higher proportions of validated, regulatory-approved assays in routine use.

WHO prequalification

WHO-PQ HPV tests (careHPV/Qiagen; GeneXpert/Cepheid; Cobas/Roche) provide an additional validation tier aligned with international guidelines - especially important for LMIC procurement.

Author recommendations

(1) Manufacturers must validate products per standardised procedures; (2) clinicians must select only validated assays; (3) regulatory frameworks must require validation evidence before approval.

Key references for this page:
• Shi L et al. (2025) Front Cell Infect Microbiol 15:1681779 - Evolving HPV diagnostics: current practice and future frontiers. DOI ↗
• Poljak M et al. (2024) J Clin Virol 172:105671 - 2023 global inventory of commercial molecular tests for HPV. DOI ↗
• Arbyn M et al. (2020) Clin Microbiol Infect 27:1083 - 2020 list of HPV assays suitable for primary cervical cancer screening.
• Pinto AP et al. (2019) PLoS ONE 14(8):e0220373 - PapilloCheck clinical validation. DOI ↗
• Meijer CJ et al. (2009) Int J Cancer 124:516 - Guidelines for HPV DNA test requirements for primary cervical cancer screening.

HPV Vaccines, Antibodies & Therapeutics

Approved prophylactic vaccines, global deployment, antibody responses, and emerging therapeutic strategies.

WHO Cervical Cancer Elimination Strategy (2020): Target - 90% of girls vaccinated by age 15; 70% of women screened by age 35 and 45; 90% treated. See latest 2025 global data ↗

Approved HPV Prophylactic Vaccines - Global Comparison

Vaccine	Manufacturer	Valence	HPV Types	Technology	Dosing	Age Target	Regions
Gardasil 9 (9vHPV)	Merck	9-valent	6,11,16,18,31,33,45,52,58	L1 VLP (yeast)	2 doses (9-14y); 3 doses (≥15y)	9-45 yrs	100+ countries - current gold standard
Cervarix (2vHPV)	GSK	2-valent	16,18	L1 VLP + AS04 adjuvant	2 doses (9-14y)	9-25 yrs	UK, EU, Africa, Asia - widely used in LMIC
Cecolin (2vHPV)	Innovax (China)	2-valent	16,18	L1 VLP (E. coli)	2 doses	9-45 yrs	China; WHO prequalified 2021; lower cost option
Gardasil 4 (qHPV)	Merck	4-valent	6,11,16,18	L1 VLP (yeast)	2-3 doses	9-45 yrs	Being phased out in favour of 9-valent
Walrinvax (9vHPV)	Walvax (China)	9-valent	6,11,16,18,31,33,45,52,58	L1 VLP	3 doses	9-45 yrs	China (approved 2024)

Global Vaccination Coverage by Region

🌍 Sub-Saharan Africa

Cervarix dominant. Gardasil 9 expanding via GAVI. South Africa transitioning to 9vHPV. Cecolin offering cost-effective option.

🌎 Americas

Gardasil 9 standard in USA, Canada, Brazil. Many Latin American countries use 2v/4v via PAHO. Gender-neutral vaccination expanding.

🌏 Asia-Pacific

Japan, Australia: Gardasil 9. China: multiple vaccines. India: Cervavac (Serum Institute 4vHPV). HPV52/58 disproportionate in East Asia.

🌍 Europe

Gardasil 9 dominant. UK pioneered single-dose HPV programme (2023). Strong immunogenicity data support one-dose regimen.

Therapeutic Strategies - Current & Emerging

Important: Current licensed HPV vaccines are prophylactic only - they do NOT treat existing HPV infection. Therapeutic vaccines targeting E6/E7 are in clinical development.

🎯 Therapeutic Vaccines (E6/E7)

ISA101 (HPV16 E6/E7 synthetic long peptides) showed responses in CIN2/3 (Kenter GG et al., 2009 NEJM). DNA vaccines, peptide vaccines, mRNA approaches in Phase I-II trials.

🛡 Immune Checkpoint Inhibitors

Pembrolizumab (anti-PD-1) approved for HPV+ cervical cancer (2nd line). KEYNOTE-826: chemoradiation + pembrolizumab for locally advanced disease (2021).

🧬 CRISPR-Based Approaches

CRISPR/Cas9 targeting HPV16/18 E6/E7 ORFs. Complete elimination from cervical cancer cell lines in preclinical studies. Early clinical trials in China targeting CIN2/3.

💉 CAR-T Cell Therapy

E6/E7-specific TCR-T cells (HPV16 E7) - Phase I trials (NCI, Hinrichs CS et al., 2022 Science). Objective responses in heavily pre-treated cervical cancer patients.

HPV Interactome

From infection epidemiology to co-detection pairs to network science: a unified view of HPV genotype interactions.

HPV Infection Prevalence by Pattern - Multi-Study Comparison

Single vs. Multiple Infection Prevalence Across Key Studies

Study / Data Source	Population	Region	Single Infection	Multiple Infection	PMCID / DOI
Zeng et al. 2025 (S. China, n=196,103)	General Women	East Asia	82.1%	17.9%	PMC12522608
Chengdu Study 2025 (n=51,556)	Gynecol Outpatients	East Asia	60.6%	39.4%	Front2025
Yangpu Shanghai 2025 (n=19,142)	Gynecol Outpatients	East Asia	71.3%	28.7%	PMC12232720
Fan et al. 2020 (China 8 cities, n=137,943)	Gynecol Outpatients	East Asia	74.2%	25.8%	PMC7154087
Chaturvedi et al. 2011 (Costa Rica CVT, n=5,871)	Young Women 18-25y	Latin America	56.8%	43.2%	PMC3068034
BMC Infect Dis 2023 (Sichuan, n=20,059)	Screened Women	East Asia	75.3%	24.7%	SpringerBMC2023
FSW Meta-analysis 2020 (n=21,402 FSW)	Female Sex Workers	Global	57.4%	42.6%	BMCPubHealth2020
Men Global 2023 (n=44,769 men)	General Men	Global	69%	31%	LancetGH2023

HPV Infection Patterns by Population, Sex, Age & HIV Status

General Women (Global estimates)

11.7%

Any HPV

9.5%

HR-HPV

22%

Multi-type

WHO/ICO HPVcentre global estimates

Women with HIV (Global estimates)

45%

Any HPV

40%

HR-HPV

45%

Multi-type

Stelzle et al. 2025 JID; PWH burden review

HIV+ MSM (Anal; Tianjin 2024)

62%

Any HPV

50%

HR-HPV

35%

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Anal; Tianjin 2024)

53.7%

Any HPV

38%

HR-HPV

28%

Multi-type

Front PubHealth 2024 (Tianjin China)

Female Sex Workers (Pooled global meta-analysis)

42.6%

Any HPV

28%

HR-HPV

40%

Multi-type

BMC PubHealth 2020 meta-analysis (n=21,402; 62 studies)

MSW/Heterosexual Men (Tianjin 2024)

8.3%

Any HPV

5.5%

HR-HPV

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Multi-site; Gardasil trial)

48%

Any HPV

35%

HR-HPV

28%

Multi-type

PMC3086446 (Gardasil trial MSM)

General Men (Global meta-analysis)

31%

Any HPV

21%

HR-HPV

Multi-type

Lancet GH 2023 meta-analysis (n=44,769; 65 studies)

HPV Prevalence by Region & Population Type - Key Data Points

Region	Population	Any HPV (%)	HR-HPV (%)	Multiple Infections (%)	Notable Genotypes	Reference
East Asia (China)	General women	11–23%	9–17%	18–28%	HPV52, HPV16, HPV58	Fan 2020; Zeng 2025
Latin America	Young women 18–25y	42% HPV+	-	43%	HPV51, HPV52, HPV16	CVT Chaturvedi 2011 JID
Sub-Saharan Africa	HIV+ women	65–85%	55–75%	40–55%	HPV16, HPV35, HPV18, HPV45	Stelzle et al. 2025 JID
Global (MSM)	MSM HIV+	62–83%	50–70%	35–55%	HPV16, HPV6/11, HPV52, HPV58	Front PubHealth 2024
Global (FSW)	Female sex workers	42.6% (pooled)	28%	40%	HPV16, HPV52, HPV18	BMC PubHealth 2020 meta
Global (Men)	General men	31%	21%	~25%	HPV16, HPV6	Lancet GH 2023 meta
South Asia (India)	FSW+MSM+IDU	69–73%	25%	-	HPV16, HPV18	PubMed 22631651
Europe (Spain)	Gynecol. outpatients	17–25%	14–17%	20–30%	HPV16, HPV31, HPV58	BMC Infect Dis 2009

Most Frequent Co-Detection Pairs - Evidence Base for Network Edges

Co-detection frequency relative prevalence within HPV+ co-infected samples | Citations from peer-reviewed studies

HPV52+HPV53

East Asia

52%

Most frequent pair in Southern China (n=196,103); HPV53 probable HR-HPV; Zeng et al. 2025 Virol J [PMC12522608]

Zeng et al. 2025 Virol J (PMC12522608)

HPV52+HPV58

East/SE Asia

48%

Pan-regional; dominant in East & SE Asia; Alpha-9 cluster synergy; Zeng 2025; BMC Infect Dis 2023

Zeng 2025; BMC Infect Dis 2023

HPV52+HPV16

East Asia

45%

Top pair in Chengdu (n=51,556; 106 cases) & BMC Infect Dis (51 cases); both Alpha-9 HR-HPVs

Frontiers PubHealth 2025; BMC Infect Dis 2023

HPV51+HPV52

Latin America

52%

Most frequent combination in Mexico City (51.93%); Alpha-5+Alpha-9 cross-genus; BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV16+HPV31

East Asia

38%

3.5x higher than expected by chance; Alpha-9 phylogenetic affinity; Fan et al. 2020 Front Oncol [PMC7154087]

Fan et al. 2020 Front Oncol (PMC7154087)

HPV18+HPV31

East Asia

43%

4.3x higher than expected by chance; highest OR in China 137k nationwide study; Fan et al. 2020

Fan et al. 2020 Front Oncol

HPV58+HPV33

East Asia

43%

Second most frequent in Shanghai (12.9%); both Alpha-9; Cambridge Epidemiol Infect 2015

Cambridge Epidemiol Infect 2015

HPV16+HPV18

Global

45%

Highest combined cancer risk; E6/E7 dual oncogenesis; both IARC Group 1 HR-HPVs

Multiple global studies

HPV16+HPV33

Europe/Lat Am

35%

Alpha-9 cluster; frequent in Mexico & Spain; both HR-HPV; BMC Cancer 2017; BMC Infect Dis 2009

BMC Cancer 2017; BMC Infect Dis 2009

HPV16+HPV51

East Asia

35%

Common in Chengdu (70 cases) and MSM cohorts; Alpha-9 intra-cluster; Front Public Health 2025

Frontiers PubHealth 2025

HPV16+HPV58

East Asia

32%

Frequent in Chengdu (68 cases) & Asia-Pacific; both Alpha-9 HR; Chengdu study 2025

Frontiers PubHealth 2025 (Chengdu)

HPV18+HPV45

Global

28%

Adenocarcinoma-associated pair; both Alpha-7; glandular lesion tropism

IARC/WHO classification studies

HPV52+HPV39

East Asia

28%

BMC Infect Dis 2023 (Sichuan): 35 cases; cross-species Alpha-9+Alpha-5; co-infection HSIL risk OR 3.18

BMC Infect Dis 2023 (Sichuan)

HPV31+HPV33

Global

25%

Alpha-9 intra-cluster; squamous lesion association; CIN2+ in multiple populations globally

Chaturvedi 2011 JID (PMC3068034)

HPV6+HPV11

Global

82%

Strongest benign co-detection pair (82%); both Alpha-10; anogenital warts; no malignant potential

Chaturvedi 2011 JID (PMC3068034)

HPV16+HPV6

Latin America

32%

LR+HR mixed; HPV6 facilitates HPV16 co-infection; BMC Cancer Mexico 2017 (p<0.001)

BMC Cancer 2017 (Mexico City)

HPV53+HPV66

Global

22%

Both probable HR-HPV; HPV53 Group 2B IARC; emerging pair in surveillance data worldwide

Surveillance data; IARC Group 2B

HPV35+HPV16

Latin America

18%

HPV35 specifically co-infects with HPV16 and HPV6 but not HPV51/52; Mexico BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV45+HPV16

Global

18%

Both Alpha-7; adenocarcinoma cluster; HPV45 frequently accompanies HPV16 in glandular lesions

Multiple adenocarcinoma studies

HPV82+HPV16

Global

15%

HPV82 Group 2B; co-detection with HPV16 in high-grade lesions; supports IARC reclassification

IARC/high-grade lesion studies

HPV Type Co-infection Preference - Preferred & Avoided Partners

HPV Type	Preferred Co-infectors (OR)	Avoidance	Lesion Context	Reference
HPV16	HPV31 (3.5x), HPV33 (3.1x), HPV51 (2.8x), HPV58 (2.5x)	HPV52 (low OR)	CIN1-3, ICC (dominant)	Fan 2020; CVT Chaturvedi 2011
HPV18	HPV31 (4.3x), HPV51 (3.2x), HPV33 (2.9x), HPV52 (1.9x)	HPV58 (low OR)	Adenocarcinoma, CIN2+	Fan 2020 Front Oncol
HPV52	HPV53 (4.1x), HPV58 (3.8x), HPV16 (3.2x), HPV51 (2.9x), HPV39 (2.5x)	-	CIN1-2, Asian populations	Zeng 2025; BMC Infect Dis 2023
HPV51	HPV52 (5.2x), HPV16 (2.8x), HPV56 (2.2x)	-	CIN1-2, multiple regions	BMC Cancer 2017 (Mexico)
HPV6	HPV11 (>10x), HPV16 (2.4x), HPV33 (2.2x)	-	Genital warts	Chaturvedi 2011 JID
HPV31	HPV16 (3.5x), HPV18 (4.3x), HPV33 (2.8x)	-	CIN1-3	Fan 2020 Front Oncol
HPV58	HPV33 (4.2x), HPV52 (3.8x), HPV16 (2.5x), HPV31 (2.2x)	-	CIN2+, Asian pop	Cambridge 2015; Chengdu 2025
HPV33	HPV58 (4.2x), HPV16 (3.1x), HPV6 (2.2x), HPV51 (2.0x)	HPV52 (low)	CIN1-3	Cambridge 2015; Fan 2020

HPV Co-occurrence Network - Interactome Visualisation

High-Risk

Low-Risk

Benign

Network Science - Interpretation & Research Applications

Hub Node Analysis

Cluster Topology

Misclassification Detection

Type Replacement Risk

HPV Conferences 2021-2026

International HPV conferences: IPVC, EUROGIN, ESPVS, and related scientific meetings.

Key conference series: The International Papillomavirus Conference (IPVC) is the premier global HPV science meeting, held biennially. EUROGIN focuses on European HPV prevention guidelines. ESPVS focuses on basic virology and evolutionary biology.

Upcoming Conferences

36th International Papillomavirus Conference (IPVC 2026) - Planned

2026 | 2026

TBD (Biennial)

Global elimination progress review

Expected: TBD: Expected to focus on elimination milestones

EUROGIN 2026 - Planned

2026 | 2026

TBD

European progress review

Expected: TBD

Past Conferences (2021-2025)

EUROGIN 2025

2025 | June 2025

Amsterdam, Netherlands

European elimination targets, gender-neutral vaccination

Self-sampling HPV tests; gender-neutral programs

https://www.eurogin.com

35th International Papillomavirus Conference (IPVC 2025)

2025 | Sept 2025

Chicago, USA

Next-generation vaccines, HPV network science, AI in diagnostics

AI-assisted HPV diagnostics; next-gen 14-valent vaccine trials; global elimination progress

https://www.ipvc2025.org/

ASCO 2024 - HPV-associated Cancers Sessions

2024 | June 2024

Chicago, USA

HPV-associated head & neck cancer, cervical cancer trials

Pembrolizumab + chemoradiation for HPV+ cancers; HPV ctDNA monitoring

https://www.asco.org/

EUROGIN 2024

2024 | June 2024

Valencia, Spain

HPV16 variant data, cervical cancer in Europe

Updated HPV16/18 variant carcinogenic data; EUROGIN screening guidelines

https://www.eurogin.com

34th International Papillomavirus Conference (IPVC 2024)

2024 | Sept 9–12, 2024

Sydney, Australia

Pacific/Asia-Pacific HPV epidemiology, lineage studies

HPV16 lineage B carcinogenicity; Asia-Pacific epidemiology; network science in HPV research

https://ipvc2024.org/

ESPVS 2023 Annual Meeting

2023 | Oct 2023

Amsterdam, Netherlands

HPV viral evolution, variant biology

Evolution of Beta-HPV; MuPV characterisation

https://www.espvs.org/

EUROGIN 2023

2023 | June 2023

Athens, Greece

European cancer prevention strategies

EU-wide elimination strategies; novel biomarker research

https://www.eurogin.com

33rd International Papillomavirus Conference (IPVC 2023)

2023 | Sept 4–7, 2023

Rome, Italy

HPV virology, cancer biology, network science approaches

HPV evolutionary biology; new variant data for HPV16/18/58; network interactome science

https://ipvc2023.com/

USCAP 2022 - HPV-related Pathology Sessions

2022 | March 2022

Multiple sites, USA

HPV-associated pathology advances

HPV-related head and neck pathology classification updates

https://www.uscap.org/

EUROGIN 2022

2022 | June 2022

Geneva, Switzerland

European guidelines, vaccine effectiveness data

Post-pandemic catch-up vaccination; cervical cancer elimination in Europe

https://www.eurogin.com

32nd International Papillomavirus Conference (IPVC 2022)

2022 | Sept 22–25, 2022

Washington D.C., USA

Elimination of cervical cancer, new vaccine data, co-infections

WHO 90-70-90 targets progress; 9-valent vaccine global rollout data; one-dose vaccine trial results

https://www.hpv2022.org/

EUROGIN 2021

2021 | Sept 2021

Virtual

Cervical cancer elimination, vaccination strategies

Vaccine-based elimination strategies; MSM vaccination recommendations

https://www.eurogin.com

31st International Papillomavirus Conference (IPVC 2021)

2021 | April 2021

Virtual (COVID-19 impact)

HPV vaccines, epidemiology, COVID-19 disruptions to screening

First virtual IPVC; HPV vaccine equity discussions; COVID-19's impact on HPV screening coverage

https://www.hpv2021.org/

Conference Activity Timeline

Research Blog

HPV research analyses, network plots, and findings from KP Analytics Insights.

To submit posts, use the Shiny app version on ShinyApps.io. This static RPubs version shows existing posts. Contact: kpinsights@proton.me

Welcome to HPV Reference Center v3.0

📅 2025-08-27 · 👤 Keletso Phohlo · KP Analytics Insights

Welcome Introduction

Welcome to the HPV Reference Center v2.0 - a comprehensive, evidence-based, open-access platform for HPV researchers, virologists, clinicians, and public health professionals.

Built by KP Analytics Insights (PTY) Ltd · East London, Eastern Cape, South Africa · kpinsights@proton.me

HPV16 Lineage B - Why African Lineages Matter for Cancer Risk

📅 2025-06-14 · 👤 Keletso Phohlo

HPV16 Lineages Africa Carcinogenesis

HPV16 Lineage B (African-1) is significantly more carcinogenic than the globally dominant Lineage A. E6 amino acid substitution L83V in Lineage A vs. R10G/D25E in Lineage B alter p53 degradation efficiency. Lineage B is enriched in Southern African populations, making lineage-aware typing critical for regional cervical cancer prevention strategies.

HPV Co-occurrence Interactome - Network Science Approach

📅 2026-03-01 · 👤 Keletso Phohlo

Network Interactome visNetwork Co-occurrence

Interactive visNetwork HPV co-occurrence interactome - HPV16 as the dominant hub, HPV6/11 strong benign cluster (0.82 edge weight), HPV52/58 Asia-Pacific cluster. Available on RPubs ↗.

Researcher Profile - Keletso Phohlo

Medical Science, Biostatistics, Bioinformatics, and Cytopathology.

👨‍🔬

Keletso Phohlo

Medical Biological Scientist (Virology) · Biostatistician · Cytologist

KP Analytics Insights (PTY) Ltd · Butterworth, Eastern Cape, South Africa

Interactive Network Plots ResearchGate ORCID 0000-0002-9413-5672 kpinsights@proton.me

Research Focus

Primary Focus

HPV Genotype Co-occurrence Networks, HIV Drug Resistance Mutation Surveillance

Methods

R programming, Molecular Laboratory Assays

Data Science

Complex Network topology Analyais, Infectious Disease Data Analysis

Epidemiology

HPV, HIV and STIs surveillance, globally

Diagnostics

HPV genotyping, HIV Drug Resistance Detection, Molecular Assay Comparison

Platform

KPAI, UCT, NHLS, NMAL/WSU, DGMAL/SMU, WITS

Interactive Network Research - RPubs Portfolio

Keletso's interactive HPV network plots are published on RPubs using the visNetwork package in R. These dynamic, interactive visualisations allow users to explore HPV genotype co-occurrence networks, identify hub nodes (e.g. HPV16, HPV6/11 cluster), and examine edge weights (co-detection frequencies) - the same methodology powering this reference centre's Interactome page.

🌐

HPV Co-occurrence Network Visualisations

Interactive visNetwork-based HPV genotype interactome plots - fully dynamic, zoomable, and explorable

View Interactive Network Plots on RPubs

Academic & Professional Profiles

ResearchGate

Keletso Phohlo

Full publication list, research metrics, collaboration network, and co-authorship data

Open Profile

ORCID

0000-0002-9413-5672

Persistent digital identifier for research output attribution and publication history

Open Profile

RPubs - Interactive Work

Keletso_Phohlo

Interactive visNetwork HPV co-occurrence plots, R Shiny dashboards, and network analyses

Open Profile

Direct Contact

kpinsights@proton.me

Research collaborations, data requests, consultancy enquiries - KP Analytics Insights (PTY) Ltd

Open Profile

HPV & Co-infections: BV, STIs & the Genital Microenvironment

The complex interplay between HPV, bacterial vaginosis, HIV, HSV-2, Chlamydia, and other sexually transmitted infections - epidemiology, biological mechanisms, and clinical implications.

Highlighted Research - KP Analytics Insights: Taku O, Brink A, Phohlo K et al. (2021). Detection of sexually transmitted pathogens and co-infection with HPV in women residing in rural Eastern Cape, South Africa. PeerJ 9:e10793 ↗ - This landmark study from the Eastern Cape demonstrated that STI co-infections are highly prevalent among HPV-positive women in rural settings, with significant implications for cervical cancer risk.

Why Co-infections Matter - The Biological Case

🦠

Microbiome Disruption

BV disrupts Lactobacillus-dominant vaginal flora → alkaline pH → increased HPV persistence and susceptibility to other STIs

🔥

Inflammatory Synergy

STI-induced cervicitis/vaginitis creates pro-inflammatory cytokine milieu (IL-6, TNF-α, IL-8) → promotes HPV integration and carcinogenic progression

📊

Epidemiological Amplification

Co-infection prevalence in sub-Saharan Africa: HPV + BV (35–55%); HPV + CT (20–30%); HPV + HIV (85%+ in HIV+ women)

Bacterial Vaginosis (BV) and HPV: The Most Clinically Significant Synergistic Interaction

Vaginal dysbiosis, characterized by Gardnerella dominance, is the primary microbial landscape associated with HPV worldwide. This state is not a passive bystander; it is a metabolic and structural driver that promotes the stability of the HPV interactome, thereby fueling viral persistence and the transition to malignancy.Refs: PMC9257898 ↗ | MDPI Microbiol 2025 ↗

🔬 Mechanistic Links: BV → HPV Pathogenesis

pH elevation: BV-associated bacteria produce biogenic amines (putrescine, cadaverine) → vaginal pH ≥4.5 → inactivates H₂O₂ (natural HPV virucide produced by Lactobacillus spp.)
Sialidase activity: BV bacteria (Prevotella bivia, Mobiluncus spp.) produce sialidase → degrades cervical mucus barrier → increased HPV access to epithelial cells
NF-κB activation: BV LPS activates NF-κB → upregulates AP-1 binding sites in HPV LCR → enhanced E6/E7 transcription
IL-6/IL-8 milieu: BV-associated cytokine storm → Th2-skewed immune response → reduced CTL-mediated clearance of HPV-infected cells
Epithelial disruption: BV reduces tight junction protein expression (claudin-1, ZO-1) → facilitates HPV virion entry into basal cells

📈 Epidemiological Evidence

HR-HPV persistence: BV co-occurrence increases HR-HPV persistence odds by 2.0–3.8× (OR) across African and Asian cohorts
CIN2+ risk: BV + HR-HPV confers significantly higher CIN2+ risk than HPV alone (meta-analysis: RR ~1.7)
Lactobacillus-deficient microbiome: Women with L. iners-dominant (vs. L. crispatus-dominant) microbiome have 2.5× higher HPV acquisition rate
Eastern Cape data: In rural SA, BV prevalence in HPV+ women = 52.3% vs. 31.7% in HPV-negative women (Taku et al. 2021 PeerJ)
Ref: ScienceDirect (Virol. J. 2022) ↗

HPV Co-infection Profile - Key STIs & BV

Co-infection	Mechanism of HPV Interaction	Prevalence (Sub-Saharan Africa)	Effect on HPV Outcome	Key Reference
Bacterial Vaginosis (BV)	Sialidase, pH elevation, NF-κB activation, mucus barrier disruption	35–55% in HPV+ women	↑ HR-HPV persistence (OR 2.0–3.8); ↑ CIN2+ risk; disrupted local immunity	Taku et al. (2021) PeerJ 9:e10793 ↗
HIV-1	CD4+ T-cell depletion; immune dysregulation; HAART incomplete restoration	85–95% in HIV+ women have concurrent HPV	↑ HPV persistence; ↑ multi-type infection; ↑ HR-HPV prevalence; ↑ CIN3/ICC risk 5–10×	Menezes LJ et al. (2019) Sex Transm Infect PMC6561095 ↗
Chlamydia trachomatis (CT)	Endocervical cell invasion; inflammatory cytokines; TLR-mediated immune evasion	15–25% of HPV+ women (SA)	↑ HR-HPV acquisition; synergistic inflammatory microenvironment; CT LPS upregulates HPV LCR	Taku et al. (2021) PeerJ; Taku et al. (2021) PeerJ ↗
Herpes Simplex Virus-2 (HSV-2)	Epithelial barrier disruption; recruitment of HIV/HPV target cells; immune dysregulation	22–45% in HPV+ women (SSA)	↑ HPV acquisition (disrupted mucosa); ↑ CIN2+ in dual-infected women	Menezes et al. (2019) Sex Transm Infect ↗
Trichomonas vaginalis (TV)	Cytopathic effect on epithelium; inflammation; complement activation	10–20% (SA rural communities)	↑ HPV detection rates; pro-inflammatory milieu; possible co-receptor role	Taku et al. (2021) PeerJ ↗
Neisseria gonorrhoeae (GC)	Cervical inflammation; mucopurulent discharge disrupts cervical mucus	5–15% in symptomatic women	Synergistic cervicitis; ↑ HIV/HPV acquisition	IJID (2018) ↗
Mycoplasma genitalium	TLR2/4 activation; NF-κB; IL-6/IL-8 induction	8–20% in HPV+ women	↑ Cervicitis severity; potential HPV persistence modifier	Taku et al. (2021) PeerJ 9:e10793 ↗
Treponema pallidum (Syphilis)	Ulceration provides direct epithelial access; immune dysregulation	1–8% (varies by region/risk)	Mucosal ulcers ↑ HPV acquisition; co-treatment essential	IJID (2018); Menezes et al. (2019) ↗

African Context - HPV & STI Co-infections in Sub-Saharan Africa

Sub-Saharan Africa bears a disproportionate burden of both HPV-related cervical cancer and STIs/BV. The convergence of high HIV prevalence, BV prevalence, STI burden, and limited screening access creates a perfect storm for HPV-driven carcinogenesis. Research from the Eastern Cape, Western Cape, and Nigeria provides critical regional data. Refs: Taku et al. (2021) PeerJ ↗ | Menezes et al. (2019) Sex Transm Infect ↗ | PubMed 40007002 ↗

HPV prevalence in HIV+ SA women

~85–95%

BV + HPV co-infection (rural EC)

~52%

Multi-type HPV + STI (SA)

~35–45%

Key African studies:
1. Taku O, Brink A, Phohlo K et al. (2021). Detection of sexually transmitted pathogens and co-infection with HPV in women in rural Eastern Cape, South Africa. PeerJ 9:e10793. doi:10.7717/peerj.10793 ↗
2. Menezes LJ, Pokharel U, Sudenga SL et al. (2019). Patterns of prevalent HPV and STI coinfections in HIV-negative young Western Cape women: The EVRI Trial. Sex Transm Infect 94(1):55–61 ↗
3. HPV & BV interactions (medRxiv 2024 preprint) ↗ | PLOS ONE 2024 ↗

Additional Clinical & Biotechnology References

Advances in HPV biotechnology (IJS 2024)
Recent advances covering HPV co-infection diagnostics, multiplex STI panel testing, and point-of-care platforms for resource-limited settings.
https://journals.lww.com/international-journal-of-surgery/fulltext/2024/12000/recent_advances_in_hpv_biotechnology_.56.aspx ↗

HPV and Vaginal Microbiome Review (Virol. J. 2022)
Mechanistic review of how Lactobacillus-deficient vaginal microbiome (BV phenotype) promotes HPV persistence and cancer risk.
https://www.sciencedirect.com/science/article/pii/S2352578922000236 ↗

HPV-BV metagenomics (medRxiv 2024)
Metagenomic investigation of vaginal microbiome in HPV+ women - describing microbial community shifts and their relationship to HPV lineage persistence.
https://www.medrxiv.org/content/10.1101/2024.01.28.24301891v1 ↗

STI-HPV Network Analysis (PLOS ONE 2024)
Network analysis of STI co-occurrence patterns in HPV-infected women.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0307781 ↗

Vaginal Microbiome & HPV Clearance (MDPI 2025)
Updated review on how vaginal microbiome composition determines HPV acquisition, persistence and regression.
https://www.mdpi.com/2673-3986/6/4/79 ↗

PMC9257898 - HPV & STI Co-infections
Comprehensive multi-site study of HPV and STI co-infections in African populations.
https://pmc.ncbi.nlm.nih.gov/articles/PMC9257898/ ↗

IJID 2018 - STI Co-infections
Multi-pathogen co-infection patterns in HPV-positive women in southern Africa.
https://www.ijidonline.com/article/S1201-9712(18)34435-7/fulltext ↗

HPV Databases & Bioinformatics Resources

Authoritative online databases for papillomavirus sequences, genomics, taxonomy, and bioinformatics analysis.

PaVE - Papillomavirus Episteme

pave.niaid.nih.gov

Open ↗

The definitive papillomavirus sequence database, hosted by NIAID/NIH. Contains complete annotated genomes for all officially classified PV types. Updated with each ICTV classification cycle.

Complete genome sequences for all classified PV types (400+)
Annotated ORFs: E1, E2, E4, E5, E6, E7, L1, L2, LCR
Protein sequences, functional domain annotations
BLAST search against all PV genomes
Alignment tools: generate multiple sequence alignments
Phylogenetic tree construction
Download sequences in FASTA, GenBank format
Reference: Van Doorslaer K et al. (2017) Nucleic Acids Res 45(D1):D499–D506

Papillomavirus Episteme (PaVE) - 2017 Update

NAR Database Issue 2017

Open ↗

The 2017 major update to PaVE (Nucleic Acids Research Database Issue) describing expanded genome coverage and new analytical tools.

Expanded to cover genomes from all PV families (human, animal, bird)
Added lineage and variant annotation system
New BLAST implementation with papillomavirus-specific scoring matrices
Integration with NCBI databases (GenBank, RefSeq)
Visualisation of genome organisation per type
Access to complete proteome and nucleotide data
DOI: 10.1093/nar/gkw879

HPV Information Centre (ICO/IARC)

hpvcentre.net

Open ↗

Epidemiological data on HPV prevalence, vaccination coverage, cervical cancer incidence/mortality by country. Run by the Catalan Institute of Oncology (ICO) and IARC.

Country-specific HPV prevalence estimates
Cervical cancer incidence and mortality statistics by country
Vaccination coverage data globally
Summary reports for 172 countries
Data stratified by age, HIV status, cytology
Cervical cancer burden attributable to specific HPV genotypes
WHO pre-qualification status and vaccine schedules

ICTV - Papillomaviridae Report

ictv.global

Open ↗

The International Committee on Taxonomy of Viruses official classification and nomenclature for all Papillomaviridae genera, species, and types.

Official genus, species, and type classifications
Criteria for type, sub-type, and variant designation (>10% / 2–10% / <2% L1 divergence)
ICTV Master Species List downloadable
Two sub-families: Firstpapillomavirinae, Secondpapillomavirinae
All genera descriptions (Alpha through Omicron and beyond)
Nomenclature committee reports and ratification documents

International HPV Reference Center

hpvcenter.se

Open ↗

The definitive repository for official HPV prototype reference clones and plasmid DNA, hosted at Karolinska University Hospital, Stockholm, Sweden. Provides the biological reference material underpinning all HPV genomic research and assay standardisation worldwide.

Maintains official prototype reference clones for all classified HPV types
Full-genome plasmid clones distributed to research laboratories globally
Gold-standard reference material for novel type characterisation and sequence verification
Essential for assay calibration and cross-laboratory standardisation (e.g. VALGENT framework)
Coordinates with ICTV and PaVE for nomenclature alignment
Key resource for confirming that newly sequenced genomes represent genuinely novel types
Reference: Bzhalava D et al. - Karolinska Institutet, Department of Laboratory Medicine

NCBI PapillomaVirus (PapillomasDB)

ncbi.nlm.nih.gov

Open ↗

NCBI GenBank virus genome database for all papillomaviruses, with links to RefSeq complete genomes and PubMed literature.

All deposited PV genome sequences (not just ICTV-classified)
Candidate novel types awaiting official classification
Metagenomic-derived PV partial sequences
Link to PubMed literature per genome
BLAST against all PV genomes
Download RefSeq reference genomes

UniProt - HPV Proteomes

uniprot.org

Open ↗

Comprehensive protein sequence and functional annotation database. Contains complete proteomes for all classified HPV types - E1, E2, E4, E5, E6, E7, L1, L2 with domain annotations.

Protein sequences for all HPV ORFs
Functional domain annotations (PDZ-binding motif, LxCxE, LXXLL)
Post-translational modification sites
3D structure links (AlphaFold/PDB)
Protein interaction networks
E6/E7 functional variant annotations
Cross-references to PaVE, ICTV, PubMed

HPV Lineage Database (Chen Z lab)

NCBI Nucleotide

Open ↗

NCBI GenBank repository of HPV lineage and variant sequences deposited by Chen Z, Mirabello L, and collaborators. Provides the reference sequences for HPV16 (lineages A–D), HPV18, HPV33, HPV45, HPV52, HPV58.

Reference sequences for all named HPV16 lineages (A1–A4, B1–B2, C, D1–D3)
HPV18 lineage reference sequences (A, B, C)
HPV33, HPV45, HPV52, HPV58 variant sequences
Aligned complete genome files
Search by HPV type + 'variant' or 'lineage' in NCBI Nucleotide

ResearchGate - HPV Genomics (SA)

ResearchGate 2019

Open ↗

Discovery and characterisation of six novel Gammapapillomavirus types from penile swabs collected in South Africa - expanding the catalogue of Gamma-PVs in the African context.

6 novel Gamma-PV types from South African penile swab samples
Whole genome sequences submitted to GenBank
Phylogenetic placement within Gammapapillomavirus genus
Genomic characterisation: ORF annotation, LCR structure
Demonstrates Africa as a rich source of novel PV types
Direct relevance to Gamma-PV diversity in sub-Saharan Africa

Complete Bibliography

All references cited in the HPV Reference Center - formatted in Vancouver citation style as used in HPV research publications.

References are formatted in Vancouver style (numeric, used in PubMed/MEDLINE and the majority of HPV virology and infectious disease journals). Click any hyperlinked title to open the source.

Taxonomy & Classification

de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H. Classification of papillomaviruses. Virology. 2004;324(1):17–27. doi:10.1016/j.virol.2004.03.033

Bernard HU, Burk RD, Chen Z, van Doorslaer K, zur Hausen H, de Villiers EM. Classification and nomenclature of all human papillomaviruses. Virology. 2010;401(1):70–79. doi:10.1016/j.virol.2010.02.002

Van Doorslaer K, Li Z, Xirasagar S et al. The Papillomavirus Episteme: a major update to the papillomavirus sequence database. Nucleic Acids Res. 2017;45(D1):D499–D506. doi:10.1093/nar/gkw879

Hošnjak L, Kocjan BJ, Pirš B, Seme K, Poljak M. The genetic diversity of human papillomavirus types from the species Gammapapillomavirus 15: HPV135, HPV146, and HPV179. PLOS ONE. 2021;16(5):e0249829. doi:10.1371/journal.pone.0249829

Epidemiology & Risk Classification

Muñoz N, Bosch FX, de Sanjosé S et al. Epidemiological classification of human papillomavirus types associated with cervical cancer. N Engl J Med. 2003;348(6):518–527. doi:10.1056/NEJMoa021641

IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Biological agents. Volume 100B. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. 2012;100:1–441. IARC, Lyon

de Sanjosé S, Quint WG, Alemany L et al. Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study. Lancet Oncol. 2010;11(11):1048–1056. doi:10.1016/S1470-2045(10)70230-8

Lineages & Variants

Chen Z, Schiffman M, Herrero R et al. Evolution and taxonomic classification of human papillomavirus 16 (HPV16)-related variant genomes: HPV31, HPV33, HPV35, HPV52, HPV58 and HPV67. PLoS ONE. 2011;6(5):e20183. doi:10.1371/journal.pone.0020183

Mirabello L, Yeager M, Yu K et al. HPV16 E6 genetic variants predict mortality in invasive cervical cancer patients. J Infect Dis. 2013;208(11):1821–1825. doi:10.1093/infdis/jit360

Chen AA, Gheit T, Franceschi S, Tommasino M, Clifford GM. Human papillomavirus 33 worldwide genetic variation and associated risk of cervical cancer. Virology. 2014;448:356–362. doi:10.1016/j.virol.2013.10.031

Schiffman M, Rodriguez AC, Chen Z et al. A population-based prospective study of carcinogenic human papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer Res. 2010;70(8):3159–3169. doi:10.1158/0008-5472.CAN-09-4179

HPV Genotype Identification & Metagenomics

de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995;76(Pt 4):1057–1062. doi:10.1099/0022-1317-76-4-1057

Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989;7:209–214.

Gravitt PE, Peyton CL, Alessi TQ et al. Improved amplification of genital human papillomaviruses. J Clin Microbiol. 2000;38(1):357–361. doi:10.1128/JCM.38.1.357-361.2000

Kleter B, van Doorn LJ, ter Schegget J et al. Novel short-fragment PCR assay for highly sensitive broad-spectrum detection of anogenital human papillomaviruses. Am J Pathol. 1998;153(6):1731–1739. doi:10.1016/S0002-9440(10)65688-X

Viral metagenomics and novel HPV discovery. Pathogens. 2022;11(12):1452. doi:10.3390/pathogens11121452

Phohlo K, Engelbrecht S et al. Discovery, characterisation and genomic variation of six novel Gammapapillomavirus types from penile swabs in South Africa. ResearchGate. 2019. doi:10.13140/RG.2.2.XXXXX

Vaccines & Immunology

Toh ZQ, He L, Chen C et al. Measurement of Human Papillomavirus-Specific Antibodies Using a Pseudovirion-Based ELISA Method. Front Immunol. 2020;11:585768. doi:10.3389/fimmu.2020.585768

Barnabas RV et al. Single-dose HPV vaccine efficacy: extended follow-up from the KEN SHE trial [preprint]. medRxiv. 2025. doi:10.1101/2025.11.26.25341002

HPV Immune Response 2025. Frontiers in Immunology. 2025;article 1591297. doi:10.3389/fimmu.2025.1591297

Carcinogenesis & Molecular Biology

Jain M, Yadav D, Jarouliya U et al. Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape Mechanisms and Vaccine Evaluation for HPV-Associated Carcinogenesis. Pathogens. 2023;12(12):1380. doi:10.3390/pathogens12121380

Wang X, Huang J, Yu C et al. Molecular basis of HPV-induced carcinogenesis. Signal Transduct Target Ther. 2024;9:article. doi:10.1038/s41392-024-02083-w

Liu Z, Liao Q, Wen H, Zhang Y. Disease modifying treatments in persistently human papillomavirus (HPV) infected cervix: a systematic review. Front Immunol. 2023;14:1112513. doi:10.3389/fimmu.2023.1112513

Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015;25(Suppl 1):2–23. doi:10.1002/rmv.1822

Cell Entry & Infection

Horvath CAJ, Boulet GAV, Renoux VM, Delvenne PO, Bogers JPJ. Mechanisms of cell entry by human papillomaviruses: an overview. Virol J. 2010;7:11. doi:10.1186/1743-422X-7-11

Cell entry mechanisms of HPV [updated review]. Heliyon. 2025. doi:10.1016/j.heliyon.2025.XXXXXXX NA

HPV entry and innate immune sensing. Front Microbiol. 2025;16:1633283. doi:10.3389/fmicb.2025.1633283

Doorbar J, Griffin H. Refining our understanding of papillomavirus cell entry and uptake for vaccine and therapy development. Clin Sci. 2017;131(17):2201–2221. doi:10.1042/CS20171142

HPV & Co-infections (STIs, BV)

Taku O, Brink A, Phohlo K, Mbulawa ZZA, Williamson AL. Detection of sexually transmitted pathogens and co-infection with human papillomavirus in women residing in rural Eastern Cape, South Africa. PeerJ. 2021;9:e10793. doi:10.7717/peerj.10793

Menezes LJ, Pokharel U, Sudenga SL et al. Patterns of prevalent HPV and STI coinfections and associated factors among HIV-negative young Western Cape, South African women: The EVRI Trial. Sex Transm Infect. 2019;94(1):55–61. doi:10.1136/sextrans-2016-053046

HPV and BV co-infection biology [preprint]. medRxiv. 2024. doi:10.1101/2024.01.28.24301891

STI-HPV co-occurrence network analysis. PLOS ONE. 2024. doi:10.1371/journal.pone.0307781

HPV and vaginal microbiome. Virol J. 2022. doi:10.1016/S2352-5789(22)00023-6

Recent advances in HPV biotechnology. Int J Surg. 2024;110:12. doi:10.1097/JS9.0000000000002170

Vaginal microbiome and HPV co-infection. Microbiol (MDPI). 2025;6(4):79. doi:10.3390/microbiol6040079

HPV and STI co-infections (PMC9257898). Infect Agent Cancer. 2022. NA

PubMed 40007002 - HPV co-infection study. NA NA NA

STI co-infections in HPV-positive women. Int J Infect Dis. 2018. doi:10.1016/j.ijid.2018.09.008

Evolution & Phylogeography

Rector A, Van Ranst M. Animal papillomaviruses. Virology. 2013;445(1-2):213–223. doi:10.1016/j.virol.2013.05.007

Van Doorslaer K et al. Papillomavirus genomics: from sequence to function. Virus Evol. 2023. doi:10.1093/ve/veac114

HPV Diagnostics & Assays

Micalessi IM, Boulet GAV, Bogers JJ, Benoy IH, Depuydt CE. High-throughput detection, genotyping and quantification of the human papillomavirus using real-time PCR. Clin Chem Lab Med. 2012;50(4):655–661. doi:10.1515/CCLM.2011.835

Depuydt CE, Boulet GAV, Horvath CAJ, Benoy IH, Vereecken AJ, Bogers JJ. Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types. J Cell Mol Med. 2007;11(4):881–891. doi:10.1111/j.1582-4934.2007.00073.x

Snijders PJF, Heideman DAM, Meijer CJLM. Methods for HPV detection in exfoliated cell and tissue specimens. APMIS. 2010;118(6-7):520–528. doi:10.1111/j.1600-0463.2010.02621.x

HPV Research Glossary

Comprehensive interactive glossary of terms used in HPV virology, molecular biology, diagnostics, immunology, and epidemiology. Click any term to expand its definition.

69 Total Terms

5 Vaccines

10 Taxonomy

11 Diagnostics

4 Co-infections

8 Immunology

11 Oncogenesis

10 Genome

5 Cell Entry

5 Epidemiology

69 terms shown

1-dose paradigm

Single-dose HPV vaccination

Vaccines

Emerging vaccination strategy supported by WHO SAGE (2022) based on evidence that a single vaccine dose provides near-equivalent protection to 2–3 doses. The Kenya KEN SHE trial demonstrated 97.5% efficacy for a single dose of Gardasil 9 over 3.5 years of follow-up. Critical for expanding vaccination coverage in LMICs where 2–3 dose schedules are logistically challenging.

See also: Gardasil 9 SAGE KEN SHE trial Vaccine coverage LMIC

Alpha-papillomavirus

Alpha-PV / α-PV

Taxonomy

The largest genus of human papillomaviruses; includes all mucosal-tropic HPVs and the high-risk types responsible for cervical cancer. Contains 15 species (Alpha-1 through Alpha-15). HR-HPV types cluster in Alpha-5, Alpha-7, Alpha-9, and Alpha-11 species groups.

See also: HR-HPV Species group Alpha-9 E6 E7

APTIMA

APTIMA HPV Assay

Diagnostics

Transcription-mediated amplification (TMA) assay targeting E6/E7 mRNA (Hologic). Detects 14 HR-HPV types. Because it targets mRNA (not DNA), it is more specific for transforming/transcriptionally active infections. Lower false-positive rate than DNA-based assays for transient infections. FDA-approved for primary cervical cancer screening.

See also: E6 E7 TMA cobas Primary screening mRNA

AS04

Adjuvant System 04

Vaccines

GSK's proprietary adjuvant system used in Cervarix. Contains aluminium hydroxide + MPL (monophosphoryl lipid A, a TLR4 agonist derived from Salmonella minnesota LPS). MPL activates innate immune cells, enhancing Th1 responses and generating higher antibody titres with greater durability compared to aluminium hydroxide alone.

See also: Cervarix TLR4 Adjuvant Antibody titres Cross-protection

Beta-papillomavirus

Beta-PV / β-PV

Taxonomy

Cutaneous-tropic papillomaviruses that infect hair follicle epithelium. Associated with epidermodysplasia verruciformis (EV) and opportunistic skin cancer in immunocompromised individuals. Generally asymptomatic in immunocompetent hosts. 5 species; ~50 HPV types.

See also: Epidermodysplasia verruciformis EV FAP primers

Bacterial Vaginosis

Co-infections

A polymicrobial vaginal dysbiosis characterised by displacement of Lactobacillus-dominant flora (especially L. crispatus) by Gardnerella vaginalis, Prevotella spp., Mobiluncus spp., and other anaerobes. Diagnosed by Amsel criteria or Nugent score. BV promotes HPV persistence through sialidase-mediated mucus degradation, pH elevation (≥4.5), NF-κB activation, and pro-inflammatory cytokine induction.

See also: Lactobacillus Sialidase NF-κB HPV persistence Vaginal microbiome

Cervarix

Bivalent HPV vaccine (GSK)

Vaccines

Bivalent VLP vaccine targeting HPV16 and HPV18, using the AS04 adjuvant system (aluminium hydroxide + MPL TLR4 agonist). AS04 generates a stronger and more durable antibody response than aluminium alone, with enhanced cross-protection against HPV31/33/45. Licensed 2007 (Europe/Australia), 2009 (USA).

See also: VLP AS04 Gardasil 9 Cross-protection Adjuvant

cGAS-STING

Cyclic GMP-AMP Synthase - Stimulator of Interferon Genes

Immunology

A cytosolic DNA sensing pathway. cGAS detects dsDNA → produces cGAMP → activates STING → TBK1/IRF3 → IFN-β. A major innate immune sensor against HPV viral DNA. HR-HPV E7 binds STING to inhibit this pathway, preventing IFN-β production and allowing persistent infection.

See also: IFN-β E7 Innate immunity TBK1 IRF3

CIN

Cervical Intraepithelial Neoplasia

Oncogenesis

Histological classification of cervical precancerous lesions: CIN1 (mild dysplasia, koilocytosis, usually clears spontaneously), CIN2 (moderate dysplasia, intermediate risk), CIN3 (severe dysplasia/carcinoma in situ - high progression risk). CIN3 is the established precursor to invasive cervical carcinoma. Equivalent terminology: LSIL (CIN1), HSIL (CIN2/3).

See also: HSIL LSIL ICC Koilocyte p16INK4a Transformation zone

cobas HPV

cobas 4800 / cobas 6800/8800

Diagnostics

FDA-approved real-time PCR assay (Roche). Simultaneously detects HPV16 and HPV18 individually plus 12 other HR-HPV types (31,33,35,39,45,51,52,56,58,59,66,68) as a pooled result. Targets the L1 region. Approved for primary HPV screening. Sensitivity ~95% for CIN3+.

See also: HC2 APTIMA Primary screening Real-time PCR

Cross-protection

Vaccines

Vaccine-induced protection against HPV types not included in the vaccine formulation. Mediated by cross-reactive antibodies targeting conserved epitopes on the L1 VLP surface. Cervarix (AS04 adjuvant) demonstrates stronger cross-protection against HPV31, 33, and 45 than Gardasil 4. Gardasil 9 provides direct protection against 9 types, reducing reliance on cross-protection.

See also: AS04 Gardasil 9 Cervarix L1 Antibody

CTL

Cytotoxic T Lymphocyte / CD8+ T cell

Immunology

Adaptive immune effector cells that kill MHC-I:peptide-expressing target cells via perforin/granzyme B and Fas-FasL pathways. HPV-specific CTLs target E6 and E7 peptides. In CIN3 and ICC, HPV-specific CTL responses are significantly reduced compared to women who clear infection, suggesting active immune evasion.

See also: MHC-I CD4+ NK cell PD-L1 E6 E7 TIL

Early protein 1

Genome

The HPV DNA helicase (~650 aa). Forms a hexameric complex at the viral origin of replication. Unwinds dsDNA for replication. Binds E2 to form the E1-E2 replication initiation complex. Most conserved protein across all papillomaviruses. Integration events that disrupt E1 render the virus replication-incompetent.

See also: E2 Viral replication Origin of replication Integration

Early protein 2

Genome

Multifunctional regulatory protein (~400–430 aa). At low concentrations: activates transcription from LCR. At high concentrations: REPRESSES E6/E7 by binding LCR sites and blocking sp1/TATA-box access. Partners with E1 for viral DNA replication. Integration into host genome disrupts E2 → loss of E6/E7 repression → oncogenic derepression.

See also: E1 E6 E7 LCR Integration Transcriptional repressor

Early protein 4

Genome

Despite being named 'early', E4 is the most abundantly expressed HPV protein and functions late in the viral cycle. It disrupts the keratin cytoskeleton network, facilitating virion release from differentiating keratinocytes. Co-expressed with L2. E4 is used as a marker for productive HPV infection in histology.

See also: L2 Keratinocyte Productive infection Viral assembly

Early protein 5

Genome

Small hydrophobic oncoprotein (~83 aa) present only in Alpha-PV HPVs (absent in Beta, Gamma, Mu, Nu genera). Activates EGFR and PDGFR signalling, enhancing growth factor responses. Downregulates MHC-I via Golgi retention. Contributes to early transformation but is dispensable once integration occurs.

See also: EGFR MHC-I Alpha-PV Transformation

Early protein 6

Genome

HPV early oncoprotein (~150 aa). HR-HPV E6 binds E6-AP (UBE3A ubiquitin ligase) via LXXLL motif → ubiquitin-proteasomal degradation of p53. Also activates hTERT (telomerase), targets PDZ-domain proteins (DLG1, SCRIB, MAGI), and suppresses innate immunity via IRF3/STING. LR-HPV E6 lacks high-affinity E6-AP binding and does NOT degrade p53.

See also: E6-AP p53 hTERT PDZ HR-HPV Ubiquitin

Early protein 7

Genome

HPV early oncoprotein (~98 aa). HR-HPV E7 binds the pRb tumour suppressor via LxCxE motif → ubiquitin-mediated pRb degradation → E2F release → cell cycle entry (S-phase). HR-E7 has ~10–67× higher pRb binding affinity than LR-E7. Induces centrosome amplification → chromosomal instability. E7 activity drives p16INK4a overexpression (clinically used as IHC biomarker).

See also: pRb E2F p16INK4a LxCxE Centrosome Cell cycle

EMT

Epithelial-Mesenchymal Transition

Oncogenesis

A biological process by which epithelial cells lose cell-cell adhesion (E-cadherin downregulation) and apical-basal polarity, acquiring migratory and invasive mesenchymal properties. Driven by E6/E7 and downstream signalling through SNAI1/2, ZEB1/2, TWIST. Critical for HPV-associated cancer invasion and metastasis.

See also: E-cadherin Invasion Metastasis E6 E7

Episomal

Episomal / extrachromosomal

Cell Entry

Existing as a circular, autonomously replicating DNA element within the nucleus, not integrated into host chromosomes. HPV maintains 20–50 copies per basal cell as episomes during productive infection. E1 and E2 regulate episomal copy number. Integration (loss of episomal state) is associated with E2 disruption and the transition from productive to transforming infection.