KPAI HPV Reference v3.0

Keletso Phohlo · KP Analytics Insights (PTY) Ltd

ORCID: 0000-0002-9413-5672 | kpinsights@proton.me

🧬

KP Analytics Insights · Papillomaviridae Resource

Taxonomy Update: Papillomaviridae was separated from Polyomaviridae (former Papovaviridae) by ICTV in 2000–2005. The family now has two sub-families: Firstpapillomavirinae (contains Alpha, Beta, Gamma, Mu, Nu, Delta, and other genera) and Secondpapillomavirinae (contains only Dyodeltapapillomavirus, infecting reptiles).

Navigate the Reference Center

Taxonomy

Hierarchical classification from Family → Genus → Species → Type → Variant

Genera & Lineages

Complete ICTV taxonomy: 5 genera, 49 species, genotypes, lineages & sub-lineages

HPV Evolution

Co-speciation, migration patterns, phylogeography

Genome & Genes

Detailed E1–E7, L1–L2 gene functions

Pathology

IARC classification, CIN grading, E6/E7 mechanisms

Vaccines & Therapeutics

Gardasil 9, Cervarix, global programs, therapeutic targets

Immune Response

Innate & adaptive immunity, evasion strategies, immunotherapy

Carcinogenesis

Molecular & genetic basis of HPV-driven cancer

Cell Entry & Infection

HSPG binding, endocytosis, nuclear delivery, keratinocyte biology

Assays & Primers

Validated assays + PCR primer sequences

HPV Interactome

Infection patterns, co-detection pairs & network science

HPV & Co-infections

BV, STIs, vaginal microbiome & co-infection biology

HPV Conferences

IPVC, EUROGIN 2021–2026

Researcher Profile

KP Analytics Insights — interactive publications & profiles

Research Blog

Share your network plots & findings

HPV Databases

PaVE, PapillomaBase, PVdb — key online resources

Bibliography

Complete reference list (Vancouver format)

Core References

de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H. (2004). Classification of papillomaviruses. Virology 324(1):17–27. [118 PV types, 16 genera — foundational classification]

IARC Monographs Vol.100B (2012). Biological Agents. International Agency for Research on Cancer, Lyon. [Group 1/2A/2B HR-HPV classification]

Muñoz N, Bosch FX, de Sanjosé S et al. (2003). Epidemiological classification of HPV types associated with cervical cancer. N Engl J Med 348:518–527.

Bernard HU, Burk RD, Chen Z et al. (2010). Classification and nomenclature of papillomaviruses. Virology 401(1):70–79.

ICTV Report: Papillomaviridae (ictv.global). Current authoritative taxonomy; includes reports for all genera.

Genome-Based Taxonomic Framework

Hierarchical classification based on L1 ORF nucleotide sequence identity comparisons.

Taxonomic basis (de Villiers et al., 2004): PV type classification uses L1 ORF nucleotide sequence comparison. >10% divergence = new type; 2-10% = subtype; <2% = variant. A new type must have the complete genome cloned and deposited at the HPV Reference Center, Heidelberg. The ICTV formally separated Papillomaviridae from Polyomaviridae in 2005.

Family Sub-division (ICTV 2005): Firstpapillomavirinae — contains genera Alpha, Beta, Gamma, Delta, Epsilon, Zeta, Eta, Theta, Iota, Kappa, Lambda, Mu, Nu, Xi and others. Secondpapillomavirinae — contains only Dyodeltapapillomavirus (reptile-infecting). Previously classified under Papovaviridae.

Taxonomic Hierarchy

ORDER

↓

Unassigned

FAMILY

↓

Papillomaviridae

SUB-FAMILY

↓

Firstpapillomavirinae

Secondpapillomavirinae

GENUS

↓

Alpha

Beta

Gamma

Delta

Epsilon

Zeta

Eta

Theta

Iota

Kappa

Lambda

Omikron

SPECIES

↓

Within each genus (e.g. Alpha-9 species = HPV16)

TYPE

↓

> 10% L1 ORF divergence from closest known type

SUBTYPE

↓

2-10% L1 ORF divergence

VARIANT

↓

< 2% L1 ORF divergence (e.g. HPV16 lineages A-D)

Complete HPV Classification Table

HPV Evolution & Phylogeography

Co-speciation with vertebrate hosts, lineage migration with human populations, and evolutionary origin of Papillomaviridae.

Taxonomic History: Papillomaviridae was previously classified under Papovaviridae alongside Polyomaviridae. The ICTV formally separated the two families in 2000-2005, reflecting fundamental differences in genome organisation, replication strategy, and evolutionary history. (Bernard HU et al., 2010; ICTV)

Evolutionary Timeline

~330 million years ago

Earliest papillomavirus-like sequences in vertebrates (estimated)

PVs among the most ancient non-retroviral DNA viruses

~120–160 million years ago

Diversification with amniote radiation; reptile/bird PVs diverge

Host-virus co-evolution tightly linked to vertebrate evolution

~100 million years ago

Mammalian PV radiation begins; co-speciation hypothesis

Papillomaviridae family diversification

~65–70 million years ago

Primate PV diversification; Alpha/Beta genera separate

Mucosal vs. cutaneous tropism divergence

~20–40 million years ago

Hominid-specific HPV types emerge (HPV16-like ancestral lineage)

Human-specific HPV types evolve with Homo lineage

Present

>200 PV types identified across Papillomaviridae

Continued discovery via metagenomics

HPV16 Lineage Human Migration Patterns

Co-migration hypothesis: HPV16 lineages closely mirror human mitochondrial DNA population structure. Lineage A reflects Out-of-Africa migration (~60,000 BP), Lineage B/C are African-specific, and Lineage D follows Beringian migration to the Americas. (Schiffman M et al., 2010; Chen Z et al., 2011)

Lineage	Associated Human Population	Modern Geographic Distribution
A	European/Asian populations (Out-of-Africa migration ~60,000 BP)	Global (most common); A1 dominant in Europe, A3/A4 in Asia
B	Sub-Saharan African populations	African continent; rare outside
C	West/Central African populations	West Africa mainly
D	Native American + North American populations (Beringian migration)	Americas; highest in indigenous populations

Co-speciation Evidence

Strong phylogenetic congruence between PV tree and host mammalian tree

Alpha-PVs in great apes closely related to human Alpha-HPVs

Beta-HPVs show host-specificity (human Beta-HPV ≠ primate Beta-HPV)

Gamma-HPVs primarily human-restricted cutaneous types

Mitochondrial DNA analysis of Homo sapiens migration correlates with HPV16 lineage A/B/C/D distribution

Evolution References

Rector A & Van Ranst M (2013). Animal papillomaviruses. Virology 445(1-2):213-223.

Schiffman M et al. (2010). HPV16 variant lineages, viral persistence, and cervical neoplasia. Cancer Res 70(8):3159-69.

Chen Z et al. (2011). HPV types 16, 18, 31, 45 restricted to two phylogenetic lineages. J Virol.

Bernard HU et al. (2010). Classification of papillomaviruses. Virology 401(1):70-79.

ICTV Taxonomic Criteria (de Villiers et al., 2004 + ICTV 2023): A new HPV type requires >10% L1 ORF nucleotide divergence from the closest known type. A new species requires phylogenetic clustering + biological distinctiveness (~15-25% L1 divergence). A new genus requires major phylogenetic separation (>40% divergence) plus distinct genome organisation (e.g. E5 presence, ELR architecture). Intra-type lineages (A, B, C, D) and sub-lineages (A1, A2, B1...) differ by <2% L1 divergence.

Alphapapillomavirus Phylogenetics — Chen Z et al. 2018 Virology 516:86–101

PMC6093212 DOI: 10.1016/j.virol.2018.01.002 1,432 partial sequences 181 complete genomes 12 HPV types classified

Study scope

Alpha-5: HPV26, 51, 69, 82 — HR oncogenic clade

Alpha-6: HPV30, 53, 56, 66 — HR oncogenic clade

Alpha-11: HPV34, 73 — HR oncogenic clade

Alpha-13: HPV54 — Low-risk (monotypic)

Alpha-3: HPV61 — Low-risk (for comparison)

Tree method: Maximum likelihood (RAxML). Sequences: 6 concatenated ORFs (E6, E7, E1, E2, L2, L1) + URR. Outgroup: Saimiri sciureus PV 1/2/3.

Key findings

✓ HPV82 most diverse: 7.3% inter-lineage divergence (10 sublineages)

✓ HPV53 most complex Alpha-6: 4 lineages, D with 4 sub-lineages

✓ HPV26 most conserved: single lineage, 18 total nt changes

✓ NCR/URR most variable; L1 capsid most conserved across all types

✓ Certain lineages geographically structured (African enrichment in B/C)

✓ HPV64 reclassified as HPV34 lineage C (no longer distinct type)

✓ HPV69 separated from HPV82 — confirmed independent type

✓ Prototype 'errors' corrected for HPV51/53/54/56/69/82 references

Genomic diversity summary (Table 1 — Chen Z et al. 2018)

Type	Species	IARC	Partial n	Complete n	Genome (bp)	GC (%)	CpG sites	Lineages / Sublineages	Max divergence
HPV51	Alpha-5	Grp 1	233	22	7808–7816	38.9–39.2	140–145	A1–A4; B1–B2	~2.8%
HPV26	Alpha-5	Grp 2A	19	3	7855	38.6	145–146	A (single lineage)	<0.3%
HPV69	Alpha-5	Grp 2B	21	6	7700–7705	38.7–38.9	130–136	A1–A4	~3.0%
HPV82 ★	Alpha-5	Grp 2B	58	17	7870–7912	39.9–40.2	135–153	A1–A3; B1–B2; C1–C5	7.3% ★ max
HPV56	Alpha-6	Grp 1	260	6	7790–7866	37.9–38.0	129–134	A1–A2; B	~1.8%
HPV30	Alpha-6	Grp 2B	23	14	7843–7881	40.2–40.5	149–157	A1–A5; B	~3.5%
HPV53 ★	Alpha-6	Grp 2B	362	22	7856–7892	40.0–40.2	142–148	A; B; C; D1–D4	~4.2% (4 lin)
HPV66	Alpha-6	Grp 2B	146	10	7816–7824	38.3–38.5	128–136	A; B1–B2	~3.2%
HPV34	Alpha-11	Grp 3	25	14	7723–7790	37.8–38.2	118–125	A1–A2; B; C1–C2	~3.3%
HPV73	Alpha-11	Grp 2B	57	11	7697–7730	36.2–36.3 ★	106–109 ★	A1–A2; B	~1.5%
HPV54	Alpha-13	Grp 3 LR	121	8	7701–7760	41.8–42.0	142–154	A1–A2; B; C1–C2	~3.1%
HPV61	Alpha-3	Grp 3 LR	107	8	7989–8030 ★	45.9–46.4 ★	198–207 ★	A1–A2; B; C	~2.4%

★ = extreme value (highest/lowest) in study cohort. All inter-lineage divergence values calculated from complete genome pairwise alignments. PMC6093212

Fig. 1 — Phylogenetic tree of Alphapapillomavirus (Chen Z et al. 2018)

HR = α5,6,7,9,11 LR1 = α1,8,10,13 LR2 = α2,3,4,14

Phylogenetic tree of Alphapapillomavirus — Chen Z et al. 2018 Virology

Maximum likelihood tree (RAxML) of concatenated ORFs (E6, E7, E1, E2, L2, L1) + URR. Outgroup: Saimiri sciureus PV 1/2/3. Ancestral clades: HR (α5,6,7,9,11) | LR1 (α1,8,10,13) | LR2 (α2,3,4,14). Types in bold = sequenced in this study. Grey lines = non-human primate PVs.
© Chen Z, Schiffman M, Burk RD et al. 2018 Virology 516:86–101. NIHPA open-access (PMC6093212).

Geographic lineage associations — Chen Z et al. 2018

Sub-Saharan Africa

HPV51 B1, B2 — African enrichment

HPV82 B1, B2 — African enrichment

HPV53 D1, D2 — Highest in Africa

HPV56 B — Africa/Asia

HPV73 B — Africa-enriched

HPV34 B — Africa-enriched

Asia-Pacific

HPV51 A3, A4 — Asia-Pacific

HPV82 C3, C4 — Asian divergent

HPV53 C — Asia-Pacific

HPV30 A2, A3 — Asia-associated

HPV69 A2 — East Asia

HPV66 B2 — Asia — limited

Americas / Global

HPV51 A1, A2 — Global reference

HPV82 A1–A3 — Global reference

HPV53 D3 — Americas-associated

HPV30 A4, A5 — Americas rare

HPV69 A3 — Americas variant

HPV66 B1 — Africa/Americas

Alphapapillomavirus

ICTV Report

Host

Humans & non-human primates

Tissue Tropism

Mucosal & cutaneous epithelia

E5 Oncoprotein

Present (ELR region 300-500 bp) — unique to Alpha genus

Genome Size

~7.9-8.0 kb

ICTV Species

Risk Profile

Contains ALL 12 IARC Group 1 high-risk HPVs + low-risk genital types

Defining genomic feature: E5 oncoprotein present; contains all oncogenic HPV types

Clinical significance: Alpha-9 species group is the most oncogenic — HPV16 alone causes ~50-60% of cervical squamous cell carcinomas and ~60% of oropharyngeal squamous cell carcinomas globally. Alpha-7 (HPV18, HPV45) drives ~25% of cervical adenocarcinomas. Together, HPV16+18 account for ~70% of all cervical cancers, forming the basis of bivalent and quadrivalent vaccine design.

How Alphapapillomavirus Are Discovered & Identified

Discovery history: Alpha-HPVs were the first human papillomaviruses characterised. Harald zur Hausen's group identified HPV16 and HPV18 from cervical carcinoma tissue using Southern blot hybridisation with radioactive probes (1983-1984), work that earned him the 2008 Nobel Prize in Physiology or Medicine. Consensus PCR primers — MY09/MY11 (Manos et al., 1989) targeting the L1 ORF (~450 bp amplicon) and the improved GP5+/GP6+ system (de Roda Husman et al., 1995, ~150 bp) — enabled broad-spectrum detection of the Alpha genus from cervical swabs. The formal Alpha genus classification was established by de Villiers et al. (2004, Virology 324:17-27) based on L1 phylogenetic clustering of 118 PV types, defining the 15 species groupings now recognised by ICTV.

ASSAYS VALIDATED FOR ALPHA-PV DETECTION:

GP5+/GP6+ consensus PCR (L1, ~150 bp) — gold standard for cervical screening research

MY09/MY11 degenerate PCR (L1, ~450 bp) — original consensus primers (Manos 1989)

PGMY09/PGMY11 pooled primers — 37-type coverage; basis for Roche Linear Array

SPF10 ultra-short primers (L1, 65 bp) — optimised for degraded FFPE tissue DNA

Hybrid Capture 2 (Digene/QIAGEN) — signal amplification; first FDA-approved HR-HPV test

Cobas HPV 4800 (Roche) — real-time PCR; detects 14 HR types; FDA-approved

APTIMA HPV (Hologic) — targets E6/E7 mRNA; higher specificity (active infections)

Roche Linear Array — reverse hybridisation; types 37 genotypes simultaneously

Seegene Anyplex II HPV28 — multiplex RT-PCR; 28 types

INNO-LiPA HPV Genotyping Extra — 28 probe hybridisation strip

Alphapapillomavirus — 13 Species | Genotypes | Lineages | Sub-lineages

Click any species row to expand genotypes and lineage data

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 1

Alphapapillomavirus 1

2 genotypes

HPV32 HPV42

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 1 (2 classified):

HPV32

HPV42

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 2

Alphapapillomavirus 2

10 genotypes

HPV125 HPV3 HPV28 HPV10 HPV94 +5 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 2 (10 classified):

HPV125

HPV3

HPV28

HPV10

HPV94

HPV117

HPV78

HPV29

HPV77

HPV160

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 3

Alphapapillomavirus 3

11 genotypes | lineage data: HPV61

HPV72 HPV61 HPV62 HPV81 HPV87 +6 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 3 (11 classified):

HPV72

HPV61

lineages

HPV62

HPV81

HPV87

HPV86

HPV114

HPV84

HPV83

HPV102

HPV89

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV61 A1	A	Global (reference)	Reference	None (ref)
HPV61 A2	A	Asia/Americas	Low-risk	1-3 changes
HPV61 B	B	Africa/global	Low-risk	Multiple
HPV61 C	C	Divergent global	Low-risk	Divergent

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 4

Alphapapillomavirus 4

3 genotypes

HPV2 HPV27 HPV57

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 4 (3 classified):

HPV2

HPV27

HPV57

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 5

Alphapapillomavirus 5

4 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV26, HPV51, HPV69, HPV82

HPV26 HPV51 HPV69 HPV82

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 5 (4 classified):

HPV26

pHR

lineages

HPV51

lineages

HPV69

pHR

lineages

HPV82

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV26 A	A	Global — limited data	Reference	None (ref) — 4 nonsynonymous changes in E1/E2/L1 across all 3 genomes

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV51 A1	A	Global (reference)	Reference	None (ref)
HPV51 A2	A	Europe/Americas	Similar to A1	1-3 aa changes
HPV51 A3	A	Asia-Pacific	Similar to A1	2-4 aa changes
HPV51 A4	A	Asia	Similar to A1	3-5 aa changes
HPV51 B1	B	Africa/African-derived	Potentially elevated	Multiple African-specific
HPV51 B2	B	Africa sub-Saharan	Potentially elevated	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV69 A1	A	Global (reference)	Reference	None (ref)
HPV69 A2	A	East Asia	Similar to A1	1-2 changes
HPV69 A3	A	Americas	Similar to A1	1-3 changes
HPV69 A4	A	Africa — limited data	Similar to A1	2-3 changes

HPV82

Alpha-5 | Group 2B (Possible Carcinogen)

LINEAGE HIERARCHY:

HPV82 A

Sub-lineages: HPV82 A1 HPV82 A2 HPV82 A3

HPV82 B

Sub-lineages: HPV82 B1 HPV82 B2

HPV82 C

Sub-lineages: HPV82 C1 HPV82 C2 HPV82 C3 HPV82 C4 HPV82 C5

Genus: Alphapapillomavirus

Species: Alpha-5

Genotype: HPV82

Lineages: HPV82 A, HPV82 B, HPV82 C

Sub-lineages: HPV82 A1, HPV82 A2, HPV82 A3, HPV82 B1, HPV82 B2, HPV82 C1, HPV82 C2, HPV82 C3, HPV82 C4, HPV82 C5, HPV82 HPV82: MOST DIVERSE in Alpha-5 — 3 lineages, 10 sublineages. Inter-lineage divergence 7.3% (highest in dataset). 17 complete genomes (n=58 partial). Genome: 7870-7912 bp; GC 39.9-40.2%; CpG 135-153. A1 = reference. C lineage (5 sublineages) is highly divergent; historically housed ME180-like variants. IARC Group 2B (possible HR). Former subtype designation AE2 abolished. Chen Z et al. 2018 Virology.

Clinical note: HPV82 (Alpha-5): IARC Group 2B (possible HR) and the MOST GENETICALLY DIVERSE type in the entire Chen Z et al. 2018 study — 10 sublineages across 3 lineages (A1-A3, B1-B2, C1-C5). Inter-lineage divergence 7.3% (maximum in dataset), approaching the 10% threshold used to define new types. 17 complete genomes + 58 partial sequences. Genome 7870-7912 bp (widest size range); GC 39.9-40.2%; CpG 135-153. The C lineage harbours 5 highly divergent sublineages and may represent ancient co-divergence with distinct human populations.

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV82 A1	A	Global (reference)	Reference	None (ref)
HPV82 A2	A	Asia-Pacific	Similar	1-3 changes
HPV82 A3	A	Americas	Similar	2-4 changes
HPV82 B1	B	Africa	Potentially elevated	Multiple
HPV82 B2	B	Africa sub-Saharan	Potentially elevated	Multiple
HPV82 C1	C	Divergent global	Unknown	Highly divergent (7.3% from A)
HPV82 C2	C	Divergent — Americas	Unknown	Highly divergent
HPV82 C3	C	Divergent — Asia	Unknown	Highly divergent
HPV82 C4	C	Divergent — Africa	Unknown	Highly divergent
HPV82 C5	C	Divergent — rare	Unknown	Highly divergent

References: Chen Z et al. 2018 Virology 516:86-101 (PMC6093212) · IARC Monographs Vol.100B (2012)

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 6

Alphapapillomavirus 6

4 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV30, HPV53, HPV56, HPV66

HPV30 HPV53 HPV56 HPV66

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 6 (4 classified):

HPV30

lineages

HPV53

pHR

lineages

HPV56

lineages

HPV66

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV30 A1	A	Global (reference)	Reference	None (ref)
HPV30 A2	A	Europe/Americas	Similar	1-2 changes
HPV30 A3	A	Asia	Similar	2-3 changes
HPV30 A4	A	Africa	Similar	2-4 changes
HPV30 A5	A	Americas — rare	Similar	3-5 changes
HPV30 B	B	Africa/global	Potentially different	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV53 A	A	Global (reference)	Reference	None (ref)
HPV53 B	B	Africa/global	Potentially elevated	Multiple
HPV53 C	C	Asia-Pacific	Similar	Multiple
HPV53 D1	D	Africa	Potentially elevated	Multiple
HPV53 D2	D	Africa sub-Saharan	Potentially elevated	Multiple
HPV53 D3	D	Americas	Similar	Multiple
HPV53 D4	D	Rare/divergent	Unknown	Highly divergent

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV56 A1	A	Global (reference)	Reference	None (ref)
HPV56 A2	A	Europe/Americas	Similar to A1	1-2 aa changes
HPV56 B	B	Africa/Asia	Potentially elevated	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV66 A	A	Global (reference)	Reference	None (ref)
HPV66 B1	B	Africa/Americas	Potentially elevated	Multiple
HPV66 B2	B	Asia — limited	Unknown	Multiple

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 7

Alphapapillomavirus 7

8 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV39, HPV18, HPV45, HPV59

HPV68 HPV39 HPV70 HPV18 HPV97 +3 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 7 (8 classified):

HPV68

HPV39

lineages

HPV70

pHR

HPV18

lineages

HPV97

pHR

HPV45

lineages

HPV85

pHR

HPV59

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV39 A	A	Worldwide	Reference	None
HPV39 B	B	Regional	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV18 A	A	European/Global (reference)	Reference	None (ref)
HPV18 B	B	African	Similar to A	Multiple African-specific
HPV18 C	C	Asian-American/Indigenous American	Similar to A	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV45 A	A	Worldwide	Reference	None
HPV45 B	B	African	High	Multiple
HPV45 C	C	Asian	High	Multiple
HPV45 D	D	African-2	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV59 A	A	Worldwide	Reference	None
HPV59 B	B	Regional	High	Multiple

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 8

Alphapapillomavirus 8

5 genotypes

HPV40 HPV7 HPV43 HPV71 HPV91

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 8 (5 classified):

HPV40

HPV7

HPV43

HPV71

HPV91

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 9

Alphapapillomavirus 9

7 genotypes | ⚠ Contains IARC Group 1 oncogenic types | lineage data: HPV33, HPV58, HPV52, HPV35, HPV31, HPV16

HPV33 HPV58 HPV67 HPV52 HPV35 +2 more

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 9 (7 classified):

HPV33

lineages

HPV58

lineages

HPV67

HPV52

lineages

HPV35

lineages

HPV31

lineages

HPV16

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV33 A1	A	Worldwide (reference)	Reference	None
HPV33 A2	A	European/Americas	High	Multiple
HPV33 B	B	African/Asian	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV58 A1	A	Worldwide	Reference	None
HPV58 A2	A	Asia-Pacific	High; common in E Asia	Multiple E6 changes
HPV58 A3	A	Americas	High	Multiple
HPV58 B1	B	African	High	Multiple
HPV58 B2	B	African-2	High	Multiple
HPV58 C	C	Asian	High	Multiple
HPV58 D	D	Americas-specific	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV52 A	A	Worldwide	Reference	None
HPV52 B	B	African	High	Multiple
HPV52 C	C	Asian	High	Multiple
HPV52 D	D	Americas	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV35 A	A	Worldwide	Reference	None
HPV35 B	B	African	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV31 A	A	Worldwide	Reference	None
HPV31 B	B	African/global	High	Multiple
HPV31 C	C	Asian	High	Multiple

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV16 A1	A	European/Global (reference)	Reference	None (ref)
HPV16 A2	A	European variant	High	H78Y
HPV16 A3	A	Asian	High	D25E, I27V
HPV16 A4	A	Asian-American	High	D25E, I27V, Q14H
HPV16 B1	B	African 1	Very High	L83V + others
HPV16 B2	B	African 1	Very High	L83V, G145T
HPV16 C	C	African 2	High	African-specific
HPV16 D1	D	North American	High	E-G350 variant
HPV16 D2	D	Asian-American	High	G350
HPV16 D3	D	Haitian/Latin American	High	Multiple

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 10

Alphapapillomavirus 10

5 genotypes

HPV74 HPV44 HPV13 HPV6 HPV11

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 10 (5 classified):

HPV74

HPV44

HPV13

HPV6

HPV11

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 11

Alphapapillomavirus 11

2 genotypes | lineage data: HPV34, HPV73

HPV34 HPV73

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 11 (2 classified):

HPV34

lineages

HPV73

pHR

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV34 A1	A	Global (reference)	Reference	None (ref)
HPV34 A2	A	Europe/Americas	Similar	1-3 changes
HPV34 B	B	Africa	Unknown	Multiple
HPV34 C1	C	Divergent global	Unknown	Highly divergent
HPV34 C2	C	Divergent — rare	Unknown	Highly divergent

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV73 A1	A	Global (reference)	Reference	None (ref)
HPV73 A2	A	Asia/Americas	Similar to A1	1-3 changes
HPV73 B	B	Africa	Potentially different	Multiple

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 13

Alphapapillomavirus 13

1 genotype | lineage data: HPV54

HPV54

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 13 (1 classified):

HPV54

lineages

Lineage	Clade	Geographic Distribution	Relative Cancer Risk	E6 Changes
HPV54 A1	A	Global (reference)	Reference	None (ref — former AE9 genome)
HPV54 A2	A	Asia/Americas	Low-risk	1-3 changes
HPV54 B	B	Africa/global	Low-risk	Multiple
HPV54 C1	C	Divergent global	Low-risk	Divergent
HPV54 C2	C	Divergent — rare	Low-risk	Highly divergent

ICTV source: ICTV Report — Alphapapillomavirus

GENUS: ALPHAPAPILLOMAVIRUS | SPECIES: ALPHAPAPILLOMAVIRUS 14

Alphapapillomavirus 14

3 genotypes

HPV106 HPV90 HPV71

▼

GENOTYPES IN ALPHAPAPILLOMAVIRUS 14 (3 classified):

HPV106

HPV90

HPV71

ICTV source: ICTV Report — Alphapapillomavirus

Cross-Genus Comparison — Genomic, Biological & Epidemiological Differences

How genera differ from each other: Each genus represents a monophyletic L1-based clade with distinct genome architecture, tropism, clinical phenotype, and detectable with genus-optimised assays. No single consensus PCR detects all genera — multi-assay approaches are required for comprehensive surveillance.

Feature	Alpha-PV	Beta-PV	Gamma-PV	Mu-PV	Nu-PV
Tissue tropism	Mucosal + cutaneous	Cutaneous (EV/skin)	Cutaneous (plantar/palmar)	Cutaneous (plantar)	Cutaneous
E5 oncoprotein	✓ Present (ELR 300-500 bp)	✗ Absent (ELR <100 nt)	✗ Absent	✗ Absent (URR very large)	✗ Absent (ELR 17 nt only)
Carcinogenic types	Yes — IARC Group 1 (HPV16,18,31,33,45,52,58...)	EV/OTR cSCC (HPV5,HPV8)	None established	None	Possible (immunocomp.)
Primary detection assay	GP5+/GP6+, MY09/11, Cobas, APTIMA	FAP59/FAP64	Viral metagenomics / RCA-NGS	Type-specific PCR	Broad PCR + sequencing
Discovery era	1970s-present (zur Hausen)	1980s-present (EV patients)	2010s-present (metagenomics)	1977 (Orth et al.)	1986 (Grussendorf-Conen)
Cytoplasmic inclusions	Absent	Absent	✓ Distinctive eosinophilic	✓ Heterogeneous/filamentous	Absent
No. of human types	65+	~47	~100+	3	1
Lineages formally characterised	Yes (HPV16,18,31,33,45,52,58)	HPV5/8 variant analysis only	None established	None	None
ICTV species	13	5	27	3	1
Key clinical presentation	Genital warts, CIN, ICC, OPSCC	EV lesions, cSCC in OTR	Plantar/palmar warts	Deep plantar warts (myrmecia)	Cutaneous lesions
Genome size	~7.9-8.0 kb	~7.2-7.7 kb	~7.0-7.5 kb	~7.8-8.0 kb	~7.7 kb
E2 binding sites	Canonical ACCG motifs	Canonical	Canonical	Canonical	All sites modified

How Papillomavirus Genera Are Classified — The Science Behind Taxonomy

Core taxonomic rule: Genus assignment is phylogenetically driven — all PV types within a genus share >40% L1 ORF amino acid identity (approx. threshold), cluster monophyletically in maximum-likelihood trees, and share at least one biological/genomic feature distinguishing them from other genera (e.g., E5 presence, inclusion body morphology, ELR architecture, E2 binding site conservation).

Specimen Collection

Tissue biopsies (wart, lesion, cervix), swabs (genital, oral, skin, penile), or bulk environmental samples. Fresh-frozen, FFPE-fixed, or ethanol-preserved for DNA stability.

DNA Enrichment

Viral DNA enriched by ultracentrifugation, DNase treatment (removes linear host DNA), or phi29 rolling circle amplification (amplifies circular dsDNA genomes — ideal for intact HPV virions).

Sequencing

Illumina short-read (most common), Oxford Nanopore long-read (full ~7.9 kb in single read), or Sanger sequencing of cloned amplicons. Metagenomic approach uses random amplification without prior sequence knowledge.

Genome Assembly

De novo assembly (SPAdes, MEGAHIT). Contigs BLASTed against PaVE database (pave.niaid.nih.gov). >90% genome coverage + >10% L1 divergence = candidate novel type. Full circular genome required for ICTV submission.

Phylogenetic Placement

Maximum-likelihood phylogeny of L1 ORF sequences (MEGA, IQ-TREE, RAxML). Bootstrap support >70% for clade definition. Genus placement requires monophyletic clade membership AND biological feature congruence.

ICTV Submission

Complete genome deposited in GenBank + PaVE. ICTV PapillomaStudyGroup verifies: >10% L1 divergence for type status, genus assignment, assigns official name. Published in ICTV Reports (ictv.global).

Key references: de Villiers EM et al. (2004) Virology 324:17-27 [foundational 118-type, 16-genus classification] | Bernard HU et al. (2010) Virology 401:70-79 [updated nomenclature] | Van Doorslaer K et al. (2023) ICTV Taxonomy Reports | PaVE database: Van Doorslaer K et al. (2017) Nucleic Acids Res 45:D499-D506 | ictv.global/report/papillomaviridae

HPV Cell Entry & Keratinocyte Infection

How HPV virions bind, enter, and infect stratified squamous epithelium — from initial attachment to nuclear delivery.

Key references: Horvath CAJ et al. (2010) Virol J ↗ | HPV cell entry review (2025) Heliyon ↗ | Front Microbiol (2025) ↗ | Clin Sci (2017) HPV replication cycle ↗

HPV Entry Pathway — Interactive Step-by-Step

Virion Synthesis

Differentiated keratinocytes (upper layers)

→

HSPG Binding

L1 & L2 bind heparan sulfate proteoglycans (syndecan-1/-4) on basal keratinocytes

→

Conformational Change

L2 N-terminus exposed; furin/proprotein convertase cleavage of L2

→

Transfer to α6-integrin

Virion transfers from HSPG to α6-integrin (secondary receptor); cyclophilin B involved

→

Endocytosis

Non-classical endocytic route (not clathrin, not caveolin); tetraspanin-enriched microdomains (TEMs)

→

Endosomal Escape

L2 penetrates endosomal membrane; acidic pH required; retrograde Golgi trafficking

→

Nuclear Delivery

L2-genome complex traffics to nucleus; L2 N-terminal NLS; delivery at mitosis (nuclear envelope breakdown)

Transformation zone specificity: HPV preferentially infects the cervical squamocolumnar junction (SCJ). Reserve cells at the SCJ express unique surface markers (CK7+, CD63+) that facilitate HPV binding and entry. This anatomical specificity explains why the SCJ is the origin of nearly all cervical cancers. Horvath et al. (2010) ↗

Microabrasion hypothesis: HPV does not infect intact epithelium. Microabrasions or microtrauma expose basal keratinocytes to virion contact. This explains the sexual transmission route — genital microtrauma during intercourse exposes basal cells at the SCJ to HPV virions.

HPV Lifecycle in Stratified Squamous Epithelium

Stratification-dependent lifecycle: HPV exploits keratinocyte differentiation programme. The virus establishes in basal cells (low E6/E7), amplifies in suprabasal cells (high E6/E7), and assembles/sheds in terminally differentiated cells (L1/L2 expressed). This avoids detection in proliferating basal layers.

Epithelial Layer	Cell Type	HPV Activity	Key Viral Proteins	Immune Detection
Basal layer	Proliferating stem/transit cells	Episomal maintenance; low copy (~10–50)	E1, E2 (replication); low E6/E7	Minimal — low antigen load
Suprabasal (early)	Post-mitotic differentiating cells	Genome amplification (100–1000 copies)	E6, E7 (high); E4, E5	Some innate recognition
Suprabasal (mid)	Intermediate differentiation	Vegetative amplification; E4 disrupts keratin	E4 dominant; E5	E4 cytopathic effect visible
Superficial layers	Terminally differentiating cells	Virion assembly; L1/L2 expressed	L1, L2; E4	Koilocyte formation; minimal immune
Surface/Desquamating	Anucleate squames	Virion release; koilocytes	L1 capsid	Virion shed into environment

Cell Entry & Lifecycle References

Horvath CAJ, Boulet GAV, Renoux VM, Delvenne PO, Bogers JPJ. (2010). Mechanisms of cell entry by HPVs: an overview. Virol J 7:11.

HPV cell entry mechanisms — comprehensive review (2025). Heliyon.

HPV entry and innate immune sensing (2025). Front Microbiol 16:1633283.

McBride AA (2017). The human papillomavirus replication cycle and its role in cancer progression. Clin Sci 131(17):2201–2221.

Doorbar J et al. (2012). The biology and life-cycle of HPVs. Vaccine 30(Suppl 5):F55–F70.

HPV Genome Organisation & Gene Functions

Detailed description of HPV genomic architecture, early and late genes, and their roles in the viral life cycle and carcinogenesis.

Genome basics: HPV has a circular, double-stranded DNA genome of approximately 7,200–8,000 bp. It encodes 8 principal ORFs: 6 early (E1, E2, E4, E5, E6, E7) and 2 late (L1, L2), plus a non-coding Long Control Region (LCR, also called URR — Upstream Regulatory Region). The genome is entirely protein-coding on one strand.

Genome Map (Linearised for display, not to scale)

Circular dsDNA ~7.9 kb | All ORFs on one strand | Click genes for details

LCR/URR

Click a gene block above to see details (interactive in Shiny version)

Gene Function Summary Table

Gene	Size	Classification	Primary Function	Carcinogenic Role	Present in Genera
LCR/URR	~400–1000 bp	Regulatory	Origin of replication; transcription regulation; E2 binding sites	Lineage-specific variants affect E6/E7 expression levels	All genera
E6	~450 bp	Early	p53 degradation (HR); PDZ protein disruption; telomerase activation	Critical oncogene: p53 loss → immortalisation	All genera
E7	~294 bp	Early	pRb degradation; E2F release; centrosome duplication	Critical oncogene: pRb loss → cell cycle dysregulation	All genera
E1	~1950 bp	Early	DNA helicase; replication initiation	Viral replication — indirect role	All genera
E2	~1200 bp	Early	Transcriptional repressor of E6/E7; replication factor	Integration disrupts E2 → E6/E7 derepression	All genera
E4	~276 bp	Early/Late	Keratin disruption; virion release	Facilitates viral shedding	All genera
E5	~249 bp	Early	EGFR activation; growth factor signalling	Promotes early transformation	Alpha only
L2	~1290 bp	Late	Minor capsid; DNA encapsidation; nuclear import	Cross-neutralising vaccine target	All genera
L1	~1590 bp	Late	Major capsid protein (icosahedral T=7); type-defining sequence	VLP vaccine antigen; type classification basis	All genera

High-Risk vs Low-Risk HPV — Molecular & Immuno-Pathological Differences

Core concept: The distinction between HR-HPV and LR-HPV is not simply a clinical one — it is rooted in fundamental molecular differences in E6 and E7 protein function, p53/pRb binding affinity, immune evasion capacity, and integration potential. These differences determine whether infection remains productive (LR) or progresses toward immortalisation and carcinogenesis (HR).

E6

Oncoprotein — HR vs LR Functional Divergence

⚠ HIGH-RISK E6 (HPV16, HPV18, HPV31, HPV45...)

p53 degradation: Contains LXXLL motif enabling E6-AP (UBE3A) ubiquitin ligase recruitment → ubiquitin-proteasomal degradation of p53 → loss of apoptosis and cell cycle arrest
hTERT activation: Binds and activates telomerase reverse transcriptase promoter → cellular immortalisation
PDZ domain proteins: C-terminal PBM (PDZ-binding motif) present — targets DLG1, SCRIB, MAGI-1/2/3 → disrupts cell polarity and tight junctions
STING/IFN suppression: Targets IRF3, STING → suppresses innate interferon response
BAK/BAX apoptosis: Binds and degrades pro-apoptotic BAK → blocks intrinsic apoptosis
Specificity: HPV16 E6 has ~100× higher p53-binding affinity than LR-HPV E6

✓ LOW-RISK E6 (HPV6, HPV11, HPV42, HPV44...)

No p53 degradation: LR-HPV E6 lacks high-affinity E6-AP interaction — p53 NOT efficiently degraded; p53-mediated apoptosis intact
No hTERT activation: Cannot activate telomerase → no immortalisation mechanism
No PBM motif: C-terminal PDZ-binding motif absent (HPV6/11 E6) → no PDZ protein disruption, cell polarity maintained
Limited immune evasion: Weaker suppression of innate immune signalling
Productive infection preferred: Promotes virion production rather than integration → condylomata, papillomas
Key ref: Pim D & Banks L (2010). HPV-18 E6*I protein targets a novel cellular protein, PTPN13, using a novel LXXLL motif. Oncogene.

E7

Oncoprotein — Binding Affinity & Downstream Effects

⚠ HIGH-RISK E7

pRb degradation: HR-E7 contains high-affinity LxCxE motif (CR2 domain) binding pRb, p107, p130 → ubiquitin-proteasomal degradation → unrestricted E2F activity
Binding affinity: HPV16 E7–pRb Kd ~7 nM; HPV6 E7–pRb Kd ~470 nM (~67× lower affinity)
p16INK4a: pRb loss triggers p16 overexpression (feedback) — clinically used as IHC biomarker for HR-HPV transformation
Centrosome amplification: HR-E7 induces centrosome duplication defects → chromosomal instability (CIN)
HDAC targeting: Binds HDAC1/2 → epigenetic dysregulation of tumour suppressors

✓ LOW-RISK E7

Weaker pRb binding: LR-E7 binds pRb with much lower affinity — sufficient to extend cell cycle for productive viral replication but insufficient for stable transformation
No pRb degradation: LR-E7 does NOT proteolytically degrade pRb — merely displaces E2F; pRb levels remain normal
No p16 overexpression: pRb intact → p16INK4a feedback not triggered → p16 IHC negative
Minimal chromosomal instability: Limited centrosome effects → stable genome in LR-HPV infected cells
Key ref: Münger K et al. (1989) The E7 gene product of the HPV-16 is sufficient for transformation of NIH 3T3 cells. EMBO J.

Genomic Integration — A HR-HPV-Specific Event

HR-HPV: Integration Mechanism

Circular episomal DNA linearises preferentially within E1/E2 ORFs → integration into host chromosomes. E2 disruption → loss of E6/E7 repression → oncogenic overexpression. Integration sites often near chromosomal fragile sites (8q24/MYC, 3q28/TP63).

LR-HPV: Episomal Maintenance

LR-HPVs (HPV6, HPV11) remain episomal throughout their life cycle. Integration is extremely rare and does not drive transformation. E2 intact → E6/E7 repressed → productive virion-generating infection maintained.

LCR Sequence Divergence

HR-HPV LCR contains AP-1 (c-jun/c-fos) binding sites that respond to inflammatory stimuli → enhanced E6/E7 transcription. Lineage variants show different LCR promoter strengths — Lineage B LCR drives higher E6/E7 expression than Lineage A (contributes to differential carcinogenicity).

Immune Evasion — HR vs LR Capacity

Mechanism	HR-HPV (16, 18...)	LR-HPV (6, 11...)	Clinical Consequence
IFN-β suppression	Strong (E6→IRF3; E7→STING)	Weak	HR: delayed innate response; prolonged persistence
MHC-I downregulation	E7 represses TAP1/2/MHC-I	Minimal	HR: CTL evasion; LR: normal antigen presentation
Langerhans cell induction	Suppressed	Moderate	HR: impaired adaptive priming
PD-L1 upregulation	E7 induces PD-L1	Absent	HR: T-cell exhaustion; LR: none
Viral shedding	Reduced (episomal loss)	High (productive)	LR produces more virus; HR persists silently
Seropositivity rate	50–60% natural infection	70–80% condylomata	LR: stronger antibody response due to high antigen load

Key references: Jain M et al. (2023) Pathogens 12:1380 ↗ | Nature Signal Transduction (2024) ↗ | Münger K et al. (1989) EMBO J 8:4099 | Pim D & Banks L (2010) Oncogene | zur Hausen H (2009) Nat Rev Cancer 9:798–805

Immune Response & Host-HPV Interactions

Innate and adaptive immunity against HPV, immune evasion strategies, and immunopathogenesis.

Key reviews: Stanley MA (2025) Front Immunol ↗ | Bhattacharya N et al. (2019) Translational Oncology ↗

Innate Immune Response to HPV

🛡 Pattern Recognition & IFN Response

Keratinocytes: primary innate responders — TLR2, TLR4, TLR9 signalling
HPV dsDNA genome activates cGAS-STING pathway → IFN-β induction
HR-HPV E6/E7 actively suppress innate responses:
E6 degrades STING; inhibits TBK1/IRF3 signalling
E7 inhibits IRF1 and NF-κB — reduces IFN production
This suppression allows viral persistence and immune evasion

🔴 NK Cells & Innate Lymphocytes

NK cell activity reduced in HPV-infected epithelium
HPV downregulates NKG2D ligands → impairs NK recognition
Langerhans cells (LC) in stratified epithelium: first APC encounter
HPV L2 inhibits LC migration to lymph nodes
Result: delayed and suboptimal early immune activation

Adaptive Immune Response

CD4+ T Helper Cells

HPV-specific Th1 response critical for viral clearance
Th1: IFN-γ, TNF-α → cytotoxic response enhancement
Th2 skewing in persistent HPV infection
Treg expansion impairs effective clearance
E6/E7-specific T cells detectable years post-infection

CD8+ CTL Response

MHC-I restricted E6/E7 epitope presentation
HPV16 E6/E7 well-characterised CTL epitopes (HLA-A*02:01)
HR-HPV E7 downregulates MHC-I expression
TAP (transporter) inhibition by E5
Tumour microenvironment: exhausted T cells (PD-1+, Tim-3+)

B Cell / Antibody Response

Natural infection: low-titre anti-L1 IgG in ~70% women
Anti-L2 antibodies: broad cross-reactive, low-titre
Seroconversion may take months post-infection
No evidence antibodies drive clearance of established HPV
Vaccine: high anti-L1 VLP IgG; memory B cells persist

HPV Immune Evasion Mechanisms: HR-HPV has evolved multiple strategies to evade host immunity, explaining why chronic persistent infection occurs in ~10–15% of infected individuals and progresses to cancer over decades.

Viral Protein	Immune Evasion Mechanism	Target Pathway	Consequence
E6	Degradation of STING, IRF3 inhibition	cGAS-STING / IFN pathway	Suppressed IFN-β; impaired innate sensing
E6	p53 degradation	Apoptosis pathway	Prevents apoptotic clearance of infected cells
E7	IRF1 and NF-κB inhibition	Innate/adaptive immune signalling	Reduced IFN and cytokine production
E7	MHC-I downregulation via TAP inhibition	CTL antigen presentation	Reduced cytotoxic T cell recognition
E7	Treg induction	Adaptive immune regulation	Immunosuppressive tumour microenvironment
E5	MHC-I downregulation	Antigen presentation	Impaired CD8+ T cell killing
L2	Langerhans cell migration inhibition	Antigen-presenting cells	Delayed adaptive immune priming
Viral lifecycle	Capsid proteins expressed only in superficial cells	Immune surveillance	Avoids innate detection in basal layer

Immune Response References

Stanley MA et al. (2025). HPV immunity and immunopathogenesis. Front Immunol 16:1591297.

Bhattacharya N et al. (2019). Immune evasion in HPV-related cancers. Transl Oncol 12(9):1136–1147.

Jain M et al. (2023). Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape. Pathogens 12(12):1380.

HPV Interactome

From infection epidemiology to co-detection pairs to network science: a unified view of HPV genotype interactions.

Why network science? Co-detection pairs are the empirical foundation of the HPV interactome. When HPV types repeatedly co-occur in the same lesion at frequencies higher than expected by chance, they form network edges. The topology of these edges — which genotypes act as hubs, which cluster phylogenetically, which are structurally proximal to HPV16 — constitutes independent biological evidence for oncogenic risk, beyond IARC's carcinogenicity classifications.

HPV Infection Prevalence by Pattern — Multi-Study Comparison

General population estimates (General Women & Men) derived from WHO/ICO HPVcentre and Lancet GH 2023 meta-analysis (n=44,769 men, 65 studies). HIV+ Women: Stelzle et al. 2025 (JID). FSW: BMC Public Health 2020 meta-analysis (n=21,402, 62 studies).

Single vs. Multiple Infection Prevalence Across Key Studies

Study / Data Source	Population	Region	Single Infection	Multiple Infection	PMCID / DOI
Zeng et al. 2025 (S. China, n=196,103)	General Women	East Asia	82.1%	17.9%	PMC12522608
Chengdu Study 2025 (n=51,556)	Gynecol Outpatients	East Asia	60.6%	39.4%	Front2025
Yangpu Shanghai 2025 (n=19,142)	Gynecol Outpatients	East Asia	71.3%	28.7%	PMC12232720
Fan et al. 2020 (China 8 cities, n=137,943)	Gynecol Outpatients	East Asia	74.2%	25.8%	PMC7154087
Chaturvedi et al. 2011 (Costa Rica CVT, n=5,871)	Young Women 18-25y	Latin America	56.8%	43.2%	PMC3068034
BMC Infect Dis 2023 (Sichuan, n=20,059)	Screened Women	East Asia	75.3%	24.7%	SpringerBMC2023
FSW Meta-analysis 2020 (n=21,402 FSW)	Female Sex Workers	Global	57.4%	42.6%	BMCPubHealth2020
Men Global 2023 (n=44,769 men)	General Men	Global	69%	31%	LancetGH2023

HPV Infection Patterns by Population, Sex, Age & HIV Status

Key finding: HPV infection burden is dramatically higher in high-risk groups. HIV-positive MSM have ~8× higher any-HPV prevalence than heterosexual men, and people with HIV have 2–6× higher cervical/anal HPV prevalence than HIV-negative counterparts. These disparities directly shape the co-infection network topology.

General Women (Global estimates)

11.7%

Any HPV

9.5%

HR-HPV

22%

Multi-type

WHO/ICO HPVcentre global estimates

Women with HIV (Global estimates)

45%

Any HPV

40%

HR-HPV

45%

Multi-type

Stelzle et al. 2025 JID; PWH burden review

HIV+ MSM (Anal; Tianjin 2024)

62%

Any HPV

50%

HR-HPV

35%

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Anal; Tianjin 2024)

53.7%

Any HPV

38%

HR-HPV

28%

Multi-type

Front PubHealth 2024 (Tianjin China)

Female Sex Workers (Pooled global meta-analysis)

42.6%

Any HPV

28%

HR-HPV

40%

Multi-type

BMC PubHealth 2020 meta-analysis (n=21,402; 62 studies)

MSW/Heterosexual Men (Tianjin 2024)

8.3%

Any HPV

5.5%

HR-HPV

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Multi-site; Gardasil trial)

48%

Any HPV

35%

HR-HPV

28%

Multi-type

PMC3086446 (Gardasil trial MSM)

General Men (Global meta-analysis)

31%

Any HPV

21%

HR-HPV

—

Multi-type

Lancet GH 2023 meta-analysis (n=44,769; 65 studies)

HPV Prevalence by Region & Population Type — Key Data Points

Region	Population	Any HPV (%)	HR-HPV (%)	Multiple Infections (%)	Notable Genotypes	Reference
East Asia (China)	General women	11–23%	9–17%	18–28%	HPV52, HPV16, HPV58	Fan 2020; Zeng 2025
Latin America	Young women 18–25y	42% HPV+	—	43%	HPV51, HPV52, HPV16	CVT Chaturvedi 2011 JID
Sub-Saharan Africa	HIV+ women	65–85%	55–75%	40–55%	HPV16, HPV35, HPV18, HPV45	Stelzle et al. 2025 JID
Global (MSM)	MSM HIV+	62–83%	50–70%	35–55%	HPV16, HPV6/11, HPV52, HPV58	Front PubHealth 2024
Global (FSW)	Female sex workers	42.6% (pooled)	28%	40%	HPV16, HPV52, HPV18	BMC PubHealth 2020 meta
Global (Men)	General men	31%	21%	~25%	HPV16, HPV6	Lancet GH 2023 meta
South Asia (India)	FSW+MSM+IDU	69–73%	25%	—	HPV16, HPV18	PubMed 22631651
Europe (Spain)	Gynecol. outpatients	17–25%	14–17%	20–30%	HPV16, HPV31, HPV58	BMC Infect Dis 2009

Most Frequent Co-Detection Pairs — Evidence Base for Network Edges

Co-detection frequency relative prevalence within HPV+ co-infected samples | Citations from peer-reviewed studies

Network significance: Each pair below represents a potential network edge. Pairs with >3x expected co-occurrence (Fan et al. 2020) are marked with a star — these are structurally prioritised edges in HPV interactome models. Regional variation in dominant pairs reflects both population genetics and assay type.

HPV52+HPV53

East Asia

52%

Most frequent pair in Southern China (n=196,103); HPV53 probable HR-HPV; Zeng et al. 2025 Virol J [PMC12522608]

Zeng et al. 2025 Virol J (PMC12522608)

HPV52+HPV58

East/SE Asia

48%

Pan-regional; dominant in East & SE Asia; Alpha-9 cluster synergy; Zeng 2025; BMC Infect Dis 2023

Zeng 2025; BMC Infect Dis 2023

HPV52+HPV16

East Asia

45%

Top pair in Chengdu (n=51,556; 106 cases) & BMC Infect Dis (51 cases); both Alpha-9 HR-HPVs

Frontiers PubHealth 2025; BMC Infect Dis 2023

HPV51+HPV52

Latin America

52%

Most frequent combination in Mexico City (51.93%); Alpha-5+Alpha-9 cross-genus; BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV16+HPV31

East Asia

38%

3.5x higher than expected by chance; Alpha-9 phylogenetic affinity; Fan et al. 2020 Front Oncol [PMC7154087]

Fan et al. 2020 Front Oncol (PMC7154087)

HPV18+HPV31

East Asia

43%

4.3x higher than expected by chance; highest OR in China 137k nationwide study; Fan et al. 2020

Fan et al. 2020 Front Oncol

HPV58+HPV33

East Asia

43%

Second most frequent in Shanghai (12.9%); both Alpha-9; Cambridge Epidemiol Infect 2015

Cambridge Epidemiol Infect 2015

HPV16+HPV18

Global

45%

Highest combined cancer risk; E6/E7 dual oncogenesis; both IARC Group 1 HR-HPVs

Multiple global studies

HPV16+HPV33

Europe/Lat Am

35%

Alpha-9 cluster; frequent in Mexico & Spain; both HR-HPV; BMC Cancer 2017; BMC Infect Dis 2009

BMC Cancer 2017; BMC Infect Dis 2009

HPV16+HPV51

East Asia

35%

Common in Chengdu (70 cases) and MSM cohorts; Alpha-9 intra-cluster; Front Public Health 2025

Frontiers PubHealth 2025

HPV16+HPV58

East Asia

32%

Frequent in Chengdu (68 cases) & Asia-Pacific; both Alpha-9 HR; Chengdu study 2025

Frontiers PubHealth 2025 (Chengdu)

HPV18+HPV45

Global

28%

Adenocarcinoma-associated pair; both Alpha-7; glandular lesion tropism

IARC/WHO classification studies

HPV52+HPV39

East Asia

28%

BMC Infect Dis 2023 (Sichuan): 35 cases; cross-species Alpha-9+Alpha-5; co-infection HSIL risk OR 3.18

BMC Infect Dis 2023 (Sichuan)

HPV31+HPV33

Global

25%

Alpha-9 intra-cluster; squamous lesion association; CIN2+ in multiple populations globally

Chaturvedi 2011 JID (PMC3068034)

HPV6+HPV11

Global

82%

Strongest benign co-detection pair (82%); both Alpha-10; anogenital warts; no malignant potential

Chaturvedi 2011 JID (PMC3068034)

HPV16+HPV6

Latin America

32%

LR+HR mixed; HPV6 facilitates HPV16 co-infection; BMC Cancer Mexico 2017 (p<0.001)

BMC Cancer 2017 (Mexico City)

HPV53+HPV66

Global

22%

Both probable HR-HPV; HPV53 Group 2B IARC; emerging pair in surveillance data worldwide

Surveillance data; IARC Group 2B

HPV35+HPV16

Latin America

18%

HPV35 specifically co-infects with HPV16 and HPV6 but not HPV51/52; Mexico BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV45+HPV16

Global

18%

Both Alpha-7; adenocarcinoma cluster; HPV45 frequently accompanies HPV16 in glandular lesions

Multiple adenocarcinoma studies

HPV82+HPV16

Global

15%

HPV82 Group 2B; co-detection with HPV16 in high-grade lesions; supports IARC reclassification

IARC/high-grade lesion studies

HPV Type Co-infection Preference — Preferred & Avoided Partners

Methodology: Co-infection preference is expressed as observed/expected ratio (OR). OR >1 = co-infection occurs more often than by random chance; OR >3 = strong affinity. These ORs form the weighted edges of the HPV interactome network. Source: Fan et al. 2020 Front Oncol; Chaturvedi et al. 2011 JID; BMC Cancer 2017; Zeng et al. 2025 Virol J.

HPV Type	Preferred Co-infectors (OR)	Avoidance	Lesion Context	Reference
HPV16	HPV31 (3.5x), HPV33 (3.1x), HPV51 (2.8x), HPV58 (2.5x)	HPV52 (low OR)	CIN1-3, ICC (dominant)	Fan 2020; CVT Chaturvedi 2011
HPV18	HPV31 (4.3x), HPV51 (3.2x), HPV33 (2.9x), HPV52 (1.9x)	HPV58 (low OR)	Adenocarcinoma, CIN2+	Fan 2020 Front Oncol
HPV52	HPV53 (4.1x), HPV58 (3.8x), HPV16 (3.2x), HPV51 (2.9x), HPV39 (2.5x)	—	CIN1-2, Asian populations	Zeng 2025; BMC Infect Dis 2023
HPV51	HPV52 (5.2x), HPV16 (2.8x), HPV56 (2.2x)	—	CIN1-2, multiple regions	BMC Cancer 2017 (Mexico)
HPV6	HPV11 (>10x), HPV16 (2.4x), HPV33 (2.2x)	—	Genital warts	Chaturvedi 2011 JID
HPV31	HPV16 (3.5x), HPV18 (4.3x), HPV33 (2.8x)	—	CIN1-3	Fan 2020 Front Oncol
HPV58	HPV33 (4.2x), HPV52 (3.8x), HPV16 (2.5x), HPV31 (2.2x)	—	CIN2+, Asian pop	Cambridge 2015; Chengdu 2025
HPV33	HPV58 (4.2x), HPV16 (3.1x), HPV6 (2.2x), HPV51 (2.0x)	HPV52 (low)	CIN1-3	Cambridge 2015; Fan 2020

HPV Co-occurrence Network — Interactome Visualisation

High-Risk

Low-Risk

Benign

Network approach: Nodes = HPV genotypes; edge weight = empirical co-detection frequency from literature. Node size reflects oncogenic risk. HPV16 is the dominant hub. HPV6/HPV11 form the strongest benign cluster (edge weight 0.82). HPV52 is the most connected node in East Asian population networks. Drag nodes to explore.

IARC reclassification context: If network edges are built from assay data before IARC correction, Group 2B types (HPV67, HPV70, HPV73) may be misclassified as low-risk and excluded from HR clusters. Post-correction network topology shifts measurably — quantifying this shift is a key research application of this interactome approach.

Network Science — Interpretation & Research Applications

Hub Node Analysis

HPV16 is the most central hub in HR-HPV networks — highest degree, betweenness and closeness centrality. HPV52 is the dominant hub in East Asian population networks. Hub genotypes should be prioritised in next-generation vaccines.

Cluster Topology

Alpha-9 (HPV16/31/33/52/58) and Alpha-7 (HPV18/39/45/68) cluster together. Alpha-10 (HPV6/11) form a benign cluster. Cross-cluster edges (e.g. HPV16-HPV51) are network bridges of high surveillance value.

Misclassification Detection

HPV70, HPV73, HPV67 and HPV82 (IARC Group 2B) cluster structurally with HR-HPV types in correctly-classified networks. This topological proximity is empirical network evidence for their reclassification, independent of IFU data.

Type Replacement Risk

Random co-infection pattern (Chaturvedi 2011 JID: pooled OR=2.2 for 300 type-type pairs) suggests vaccination does not redirect infection toward non-vaccine types. Network topology monitors this assumption post-9vHPV rollout.

Pathology & HPV-Induced Carcinogenesis

From histopathological classification and IARC risk stratification through molecular oncogenesis — the complete pathway from HPV infection to invasive carcinoma.

Key reviews: Jain M et al. (2023) Pathogens ↗ | Signal Transduction & Targeted Therapy (2024) ↗ | Front Immunol (2023) ↗

Histopathological Grading — CIN & Beyond

CIN / SIL Classification System

Grade	Old Term	Bethesda	Histology	HPV Type	Progression Risk
CIN 1	Mild dysplasia	LSIL	Koilocytosis; dysplastic cells in lower 1/3 of epithelium; basal layer intact	LR and HR-HPV	~10–15% progress to CIN3 over 2 years; ~60% regress spontaneously
CIN 2	Moderate dysplasia	HSIL	Dysplasia in lower 2/3; mitotic figures in middle third; loss of polarity	HR-HPV dominant	~20% progress to CIN3/ICC; ~40% regress
CIN 3 / CIS	Severe dysplasia / Carcinoma in situ	HSIL	Full-thickness dysplasia; basement membrane intact; p16 diffusely positive	HPV16/18 dominant	~30–40% progress to ICC if untreated over 10–15 years
ICC	Invasive Cervical Carcinoma	N/A	Basement membrane breached; stromal invasion; SCC or adenocarcinoma	HPV16 (SCC), HPV18/45 (adeno)	Stage-dependent 5-yr survival: Ia 93% → IVb <15%

E6 & E7 Oncoproteins — Molecular Mechanism

E6 & E7: The Two Master Oncoproteins

E6 Oncoprotein (HR-HPVs)

Binds E6-AP ubiquitin ligase → ubiquitinates p53
Proteasomal degradation of p53 → prevents apoptosis
Activates hTERT → cell immortalisation
Disrupts PDZ domain-containing proteins (DLG1, SCRIB, MAGI)
LR-HPV E6 does NOT efficiently degrade p53
Suppresses innate immunity via STING/IRF3

E7 Oncoprotein (HR-HPVs)

Binds and degrades pRb (LxCxE motif) → releases E2F → S-phase entry
HR-HPV E7 binds pRb ~10–67× more tightly than LR-HPV E7
Induces centrosome duplication → chromosomal instability
p16INK4a overexpression = surrogate biomarker for E7 activity
HPV integration disrupts E2 → E6/E7 derepression
Upregulates PD-L1 → T-cell exhaustion

Stepwise Progression: Infection → Invasive Cancer

7-Step Molecular Pathway to Invasive Carcinoma

STEP 1 : HPV INFECTION

HPV16/18 infects basal keratinocytes at transformation zone (cervical squamocolumnar junction). Entry via heparan sulfate proteoglycans (HSPG) → conformational change in L1/L2 → endocytosis. See Cell Entry page ↗

STEP 2 : EPISOMAL REPLICATION

HPV DNA maintained as extrachromosomal episome (~20–100 copies/cell). E1/E2 drive low-level replication. E6/E7 expressed at low levels. Cell remains viable — productive lifecycle initiated.

STEP 3 : PERSISTENT INFECTION

~10–15% of HR-HPV infections persist beyond 12 months. Risk factors: viral load, specific lineage (HPV16-B variants), immunosuppression, STI co-infections (BV, HIV, CT). Persistent infection = prerequisite for malignant progression.

STEP 4 : CHROMOSOMAL INTEGRATION

HPV DNA integrates into host genome. Preferential integration at chromosomal fragile sites (3q, 8q, 13q, 17q). Integration disrupts E2 ORF → loss of E6/E7 repression → sustained oncogene overexpression. Detectable by FISH and whole-genome sequencing.

STEP 5 : E6/E7 OVEREXPRESSION → TRANSFORMATION

E6: p53 degradation → apoptosis failure + hTERT activation → immortalisation. E7: pRb degradation → uncontrolled S-phase entry + centrosome duplication → chromosomal instability (CIN). Combined: aneuploidy and clonal expansion.

STEP 6 : CIN PROGRESSION (CIN1 → CIN2 → CIN3)

Progressive epithelial involvement. CIN3 = full-thickness dysplasia. p16INK4a IHC diffusely positive (E7 surrogate). Ki-67 throughout epithelium. ~30–40% of CIN3 progress to invasive cancer without treatment. Median progression time: 10–15 years.

STEP 7 : INVASIVE CARCINOMA

Basement membrane breached. SCC (HPV16 dominant): ~70–80% ICC. Adenocarcinoma (HPV18/45): ~20–25% ICC. EMT activation, angiogenesis, lymph node and distant metastasis. Global burden: ~600,000 new cervical cancer cases per year.

Key Molecular Targets & Diagnostic Biomarkers

Oncoproteins, Tumour Suppressors & Clinical Biomarkers

p16INK4a

Surrogate for HR-HPV E7 activity. Overexpressed when pRb is degraded. Used in CIN grading (dual stain Ki-67/p16). High specificity for CIN2+ on biopsy. IHC positive = block-diffuse staining throughout epithelium.

Ki-67

Proliferation marker. Full-thickness positivity in CIN3. Dual stain (p16+/Ki-67+) highly predictive of CIN2+ in liquid-based cytology. Distinguishes CIN from mature condyloma.

p53

Tumour suppressor degraded by E6 via E6-AP ubiquitin ligase. Wild-type p53 expression lost in HR-HPV+ cancers. p53 mutation rare in HPV+ cancers — unlike HPV-negative HNSCC (TP53 mutated in ~80%).

pRb

Retinoblastoma protein degraded by E7 (LxCxE binding). Loss of pRb → uncontrolled E2F activity → S-phase entry. Upstream of p16INK4a overexpression cascade. IHC loss correlated with advanced CIN/ICC.

hTERT

Telomerase reverse transcriptase — activated by HR-HPV E6 via TERT promoter binding. Confers cellular immortalisation by preventing telomere erosion. Telomerase activity detectable in >95% of cervical cancers.

HPV ctDNA

Circulating tumour HPV DNA — emerging liquid biopsy biomarker. HPV ctDNA in plasma correlates with tumour burden and treatment response in cervical and oropharyngeal cancers. Monitored by ddPCR or targeted NGS.

PIK3CA

Most frequently mutated oncogene in HPV+ ICC (~25–30%). Activating mutations (E545K, H1047R) activate PI3K/AKT/mTOR. Targetable by PI3K inhibitors currently in clinical trials for cervical cancer.

MYC / 8q24

MYC amplification at 8q24 is a preferred HPV integration fragile site. MYC overexpression co-operates with HPV E6/E7 in driving clonal expansion. Found in ~25% of ICC with 8q24 amplification.

Pathology & Carcinogenesis References

Jain M et al. (2023). Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape and Vaccine Evaluation for HPV-Associated Carcinogenesis. Pathogens 12(12):1380.

Wang X et al. (2024). Molecular basis of HPV carcinogenesis. Signal Transduction and Targeted Therapy 9:article.

IARC Working Group (2012). Biological agents. Volume 100B. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. IARC, Lyon.

Doorbar J et al. (2012). The biology and life-cycle of human papillomaviruses. Vaccine 30(Suppl 5):F55–F70.

zur Hausen H (2002). Papillomaviruses and cancer: from basic studies to clinical application. Nat Rev Cancer 2:342–350.

Schiffman M et al. (2010). HPV and carcinogenesis — a population-based prospective study. Cancer Res 70(8):3159–3169.

HPV Assays, Primers & Risk Classification

Clinical diagnostics, surveillance platforms, and the manufacturer discrepancy crisis in HPV genotype risk labelling

24 Validated Platforms

4 Manufacturers with Labelling Discrepancies

IARC Monograph 100B (2012) — Authoritative Standard

Primers: 8 Systems Documented

Group 1 HR: HPV16,18,31,33,35,39,45,51,52,56,58,59

Group 2A pHR: HPV68

Group 2B Possibly HR: HPV26,30,34,53,66,67,69,70,73,82,85,97

Group 3 LR: HPV6,11 + all non-alpha types

IARC Monograph 100B (2012) — The Authoritative HPV Carcinogenicity Standard

IARC 100B 2025 Classification Review

Why this matters for HPV surveillance: The IARC Monograph 100B (2012) is the only peer-reviewed, globally recognised authority for HPV carcinogenicity classification. It uses a structured evidence-weighing process evaluating epidemiological studies, animal data, and mechanistic evidence. A 2025 Microorganisms review (MDPI) reaffirmed these groupings with updated evidence. Manufacturers who deviate from IARC classifications in their package inserts directly undermine the comparability of global HPV surveillance data.

Group 1

Carcinogenic to Humans

HIGH-RISK (HR) 12 types

HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59

Evidence basis

Sufficient epidemiological evidence of cervical carcinogenesis. HPV16 + HPV18 each independently classified Group 1 (IARC, updated 2009 pre-100B). Supported by multiple meta-analyses, IARC's pooled analysis of 11,000 ICC cases (Muñoz et al., 2003), and mechanistic data (E6/E7 immortalise primary keratinocytes).

Manufacturer status: All validated primary screening assays (cobas, Abbott, BD Onclarity, HC2, APTIMA) correctly include all 12 types.

HPV59 is included in 12-type 'other HR' pools; individual detection limited to full-genotyping assays.

Group 2A

Probably Carcinogenic to Humans

PROBABLY HIGH-RISK (pHR) 1 type

HPV68

Evidence basis

HPV68 subtype ME180 confers indefinite proliferation in primary keratinocytes. Limited but suggestive epidemiological evidence from the IARC ICC studies. E6/E7 of HPV68 bind and degrade p53/pRb with lower efficiency than Group 1 types (Schiffman M et al., 2009, Infect Agents Cancer 4:8).

Manufacturer status: DISCREPANCY: Some assays include HPV68 in 'other 12 HR' pools (correct grouping but obscures its pHR distinction). Roche Linear Array labels HPV68 without clear 2A annotation. INNO-LiPA correctly documents HPV68 as Group 2A in its scientific literature.

SPF10 co-amplification: HPV68 and HPV73 produce identical amplicon sizes with SPF10 primers — confirmatory type-specific PCR required.

Group 2B

Possibly Carcinogenic to Humans

POSSIBLY HIGH-RISK (possibly HR) 12+ types

HPV26, HPV53, HPV66, HPV67, HPV69, HPV70, HPV73, HPV82 (HR-clade evidence) | HPV30, HPV34, HPV85, HPV97 (phylogenetic analogy only) | HPV5, HPV8 in EV patients (Beta genus, immunosuppressed context only)

Evidence basis

For HR-clade members (HPV26/53/66/67/70/73/82): classified based on limited epidemiological evidence plus phylogenetic membership in high-risk alpha clade. HPV53/66 occasionally found in ICC specimens; HPV70/73 detected in CIN2/3 but direct causal evidence insufficient for Group 1. For phylogenetic analogy types (HPV30/34/85/97): no direct IARC meta-analysis data; assigned by analogy. 2025 Microorganisms review (MDPI 13(5):1000) reaffirmed Group 2B status with updated molecular evidence for HPV67/70/73, noting that their E6/E7 oncoproteins show intermediate binding to p53/pRb.

Manufacturer status: MAJOR DISCREPANCY: Roche Linear Array, Seegene Anyplex 28, Seegene Allplex 28, and HPV Direct Flow Chip variously label HPV67, HPV70, HPV73 as 'low-risk' — directly contradicting IARC 100B Group 2B status. This is the primary surveillance challenge identified by HPV researchers globally.

Group 2B ≠ Low-Risk. 'Possibly carcinogenic' means evidence is LIMITED, not ABSENT. These types must not be dismissed as LR in surveillance reports.

Group 3

Not Classifiable as Carcinogenic

LOW-RISK (LR) HPV6 + HPV11 primarily

HPV6, HPV11 (and all cutaneous non-alpha types without evidence)

Evidence basis

No evidence of carcinogenicity despite widespread infection. HPV6/11 cause condylomata acuminata (genital warts) and laryngeal/recurrent respiratory papillomatosis (RRP). E6/E7 do not efficiently degrade p53/pRb. No integration into host genome observed in benign lesions.

Manufacturer status: All manufacturers correctly classify HPV6 and HPV11 as low-risk. No discrepancy exists here.

Important: Many cutaneous genotypes (Beta, Gamma, Mu, Nu genera) are simply 'not classified' — insufficient data for any IARC group assignment.

Sources: IARC Monographs Volume 100B (2012) | Schiffman M et al. (2009) Infect Agents Cancer 4:8 | Bouvard V et al. (2009) Lancet Oncol | HPV Carcinogenicity Review, Microorganisms 2025 13(5):1000 ↗

Manufacturer Discrepancies — A Critical HPV Surveillance Problem

The surveillance impact: When researchers use full-genotyping assays (Linear Array, Anyplex 28, Allplex 28, HPV Direct Flow Chip) and report results using manufacturer-defined risk categories, genotypes like HPV67, HPV70, HPV73 get recorded as 'low-risk' in surveillance databases — directly contradicting their IARC Group 2B classification. Over hundreds of published studies, this creates a systematically distorted global picture of 'possibly carcinogenic' HPV prevalence. It makes inter-study comparisons impossible without reanalysis and leads to underestimation of the public health burden of Group 2B types.

GENOTYPE-BY-GENOTYPE MANUFACTURER vs IARC COMPARISON:

Type	IARC 100B	Roche Linear Array	Seegene Anyplex 28	Seegene Allplex 28	HPV Direct Flow Chip	INNO-LiPA Extra	Correct Label
HPV26	Group 2B (HR clade)	Not included	Grouped 'other HR'	Detected; ambiguous label	Not included	Group 2B — documented	2B — Possibly HR
HPV53	Group 2B (HR clade)	Detected; no clear 2B annotation	'Other HR' group	Detected; no 2B annotation	Not included	Group 2B — documented	2B — Possibly HR
HPV66	Group 2B (HR clade)	Often grouped 'other HR'; no 2B label	'Other HR' group	Detected	Detected; risk unlabelled	Group 2B — documented	2B — Possibly HR
HPV67	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Detected; discrepant (Comar 2013)	Group 2B — documented	2B — Possibly HR
HPV68	Group 2A (PROBABLY carcinogenic)	Pooled 'other HR'; 2A not annotated	Correctly pHR-documented	Detected; labelled ambiguous	Labelled LOW-RISK ⚠	Group 2A — correctly documented	2A — Probably HR
HPV69	Group 2B (phylogenetic analogy)	Not included	Not included	Not included	Not included	Not included	2B — Possibly HR
HPV70	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Group 2B — documented	2B — Possibly HR
HPV73	Group 2B (HR clade)	Detected; labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Labelled LOW-RISK ⚠	Variable; inconsistent	Group 2B*; SPF10 HPV68 co-amplification	2B — Possibly HR
HPV82	Group 2B (HR clade)	Detected; ambiguous	Detected; ambiguous label	Detected; ambiguous label	Not included	Group 2B — documented	2B — Possibly HR
HPV30	Group 2B (phylogenetic analogy)	Not included	Not included	Not included	Not included	Not included	2B — Possibly HR
HPV34	Group 2B (phylogenetic analogy)	Not included	Not included	Not included	Not included	Not included	2B — Possibly HR
HPV6	Group 3 — NOT classifiable	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	LR
HPV11	Group 3 — NOT classifiable	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	Correctly: LR ✓	LR

ASSAY-SPECIFIC DISCREPANCY PROFILES:

Roche Linear Array (LA)

LABELLING DISCREPANCY

HPV70, HPV73, HPV82 labelled 'low-risk' in package insert — contradicts IARC Group 2B
Cross-hybridisation: HPV52/HPV67 probes cross-react (van Ham et al., 2005)
HPV83 probe cross-reacts with HPV102; HPV84 with HPV86/HPV87/HPV114 (Godinez et al., 2019)
37-type coverage does not include HPV26/69/30/34 — Group 2B types missed
Result: surveillance studies using LA without IARC reclassification systematically undercount Group 2B types

van Ham MA et al. (2005) J Clin Microbiol; repository.ubn.ru.nl/handle/2066/49969

Seegene Anyplex II HPV28

LABELLING DISCREPANCY

HPV67, HPV70, HPV73 included in 28-type panel but risk labels in IFU do not reflect IARC 100B Group 2B
HPV28 panel provides excellent coverage but researcher interpretation depends on accurate risk labelling
TOCE technology reduces cross-reactivity vs. LA — technical advantage undermined by labelling inaccuracy
Result: published studies using Anyplex 28 without reclassification misclassify Group 2B infections

Seegene Anyplex II HPV28 IFU; Hesselink AT et al. (2018) J Clin Microbiol

Seegene Allplex HPV28

LABELLING DISCREPANCY

IFU (HP10373Z/HP10372X) groups HPV types with ambiguous risk annotations
HPV67, HPV70, HPV73, HPV82 risk categories not aligned with IARC 100B
Adds viral load quantification — valuable for research but only if risk categories are correct
HPV69 not included — Group 2B type with phylogenetic analogy classification missed

Allplex HPV28 IFU HP10373Z/HP10372X; Medista documentation

HPV Direct Flow CHIP

LABELLING DISCREPANCY

Discordance with INNO-LiPA for HPV66, HPV67, HPV70, HPV73 (Comar M et al., 2013)
Risk annotation for Group 2B types inconsistent with IARC 100B in product documentation
35-type coverage includes many 2B types but labels them inaccurately
Limited clinical validation data vs. VALGENT-validated assays

Comar M et al. (2013) J Virol Methods 187:54-61

INNO-LiPA HPV Genotyping Extra

IARC-ALIGNED

IARC-aligned: HPV68 correctly documented as Group 2A (probably carcinogenic)
HPV26, HPV53, HPV66, HPV70, HPV73, HPV82 documented as Group 2B in scientific IFU
Technical limitation: SPF10 produces identical amplicons for HPV68 and HPV73 — confirmatory type-specific PCR recommended
32-probe coverage with well-characterised hybridisation specificity

Fujirebio/Cosmo Bio IFU 81534; Kleter B et al. (1998) J Clin Microbiol

HPV-Risk Assay (LMNX/Self-Screen DDL)

IARC-ALIGNED

Specifically designed with IARC risk stratification built into the assay framework
54-type coverage — broadest of any commercial platform
Provides probabilistic risk scores aligned with clinical evidence rather than binary HR/LR labels
Validated in VALGENT framework; non-inferior to HC2

Hesselink AT et al. (2014) J Clin Microbiol 52:3799

How Researchers Can Rectify These Discrepancies

Always cite IARC 100B as reference standard

In all publications and surveillance reports, explicitly state risk classifications follow IARC Monograph Volume 100B (2012) — not manufacturer package inserts. Include a 'Risk Classification Note' in your methods section.

Post-hoc reclassification of raw genotype data

When using LA, Anyplex 28/Allplex 28, or Flow Chip data: reclassify HPV67→Group 2B, HPV70→Group 2B, HPV73→Group 2B, HPV68→Group 2A before any analysis. Provide the reclassification table as supplementary data.

Confirmatory assay for ambiguous Group 2B types

For HPV68/HPV73 (identical SPF10 amplicons): use type-specific PCR or E7 gene sequencing for confirmation. For HPV70 detected by LA: confirm with NGS or type-specific PCR in high-burden samples.

Engage manufacturers via formal channels

Researchers and clinicians can formally request that Roche, Seegene, and Master Diagnostica update IFUs to align with IARC 100B. Letters to manufacturers cc'd to IARC, WHO-PAHO, and IPVS create audit trails for regulatory updates.

Use IARC-aligned assays when possible for surveillance

INNO-LiPA HPV Genotyping Extra and HPV-Risk Assay (LMNX) have the most accurate IARC-aligned labelling among full-genotyping platforms. Recommend these for surveillance studies where Group 2B classification matters.

Advocate for regulatory update of IFU requirements

CE-IVD and FDA 510(k) frameworks should require alignment with IARC 100B for risk-category labelling. Professional societies (IPVS, EUROGIN, ASCCP) can petition regulatory bodies (EMA, FDA) to mandate this through position statements.

Key publications on assay discrepancies:
• van Ham MA et al. (2005) J Clin Microbiol — Cross-hybridisation in Roche Linear Array; HPV52/67 probe issues. PDF ↗
• Comar M et al. (2013) J Virol Methods 187:54-61 — HPV Direct Flow Chip vs INNO-LiPA discordance for HPV66/67/70/73. Full text ↗
• Godinez JM et al. (2019) Diagn Pathol 14:35 — Roche LA cross-hybridisation for HPV83/84/102/86/87/114 probes.
• Arbyn M et al. (2015) J Clin Virol 76:S14 — VALGENT clinical validation framework for HPV assays.
• Bouvard V et al. (2009) Lancet Oncol 10:321-322 — IARC Group 2B evidence review for possibly carcinogenic HPVs.
• Fujirebio IFU 81534 (2016) — INNO-LiPA HPV Genotyping Extra package insert with IARC-aligned risk annotations. PDF ↗

24 Validated HPV Assay Platforms — Full Comparison Table

⚠ DISCREPANCY ✓ IARC-Aligned ~ Partial

Clinical validation standard (Meijer criteria, 2009 / VALGENT framework): An HPV test for cervical cancer primary screening must achieve: sensitivity ≥90% for CIN2+ vs. colposcopy, specificity within 2% of HC2, ≥85% intra-laboratory and ≥75% inter-laboratory κ for reproducibility. Second-generation comparators: cobas 4800, Abbott RealTime, BD Onclarity, Anyplex II (Arbyn et al., 2015). The IARC Risk Label column flags which assays have labelling discrepancies for Group 2B types. References: Arbyn M et al. 2021 CMI ↗ | IHRC Genotyping Technical Report 2022 ↗

PCR Primer Systems — Complete Sequences, Targets & Applications

Critical primer limitation: No single PCR primer set detects all 5 human PV genera (Alpha, Beta, Gamma, Mu, Nu) reliably. GP5+/GP6+ and MY09/MY11 target Alpha-HPV L1 only. FAP59/FAP64 targets Beta-HPV only. Gamma/Mu/Nu types require metagenomic approaches or broad-spectrum degenerate CpI/CPIIG primers. SPF10 (65 bp) is optimal for degraded FFPE DNA but produces identical amplicons for HPV68/HPV73.

Primer System	Primer Name	Sequence 5'→3'	Target	Amplicon	Types Detected	Application	Reference
GP5+/GP6+	GP5+	TTTGTTACTGTGGTAGATACTAC	L1	150 bp	~40 HPV genotypes	Gold standard for screening/research; used in POBASCAM, VALGENT trials	de Roda Husman et al. (1995) JGV
GP5+/GP6+	GP6+	GAAAAATAAACTGTAAATCATATTC	L1	—	—	—	—
MY09/MY11	MY09	CGICCIGGIBOWICCITARTCWGG	L1	450 bp	~30 mucosal HPV	Clinical & research genotyping; basis of HC2 probe design	Manos et al. (1989)
MY09/MY11	MY11	GCMCAGGGWCATAAYAATGG	L1	—	—	—	—
PGMY09/PGMY11	PGMY09	GCMCAGGGWCATAAYAATGG (degenerate mix of 9)	L1	450 bp	>40 genotypes	Linear Array assay; research genotyping; FDA-cleared as lab test	Gravitt et al. (2000) JCM
PGMY09/PGMY11	PGMY11	TTTGTTACTGTGGTAGATACTAC (degenerate mix of 13)	L1	—	—	—	—
SPF10	SPF1c	CCTTGTTRCAYGGGGCNGT	L1	65 bp	Wide spectrum	Research; high sensitivity short amplicon for FFPE	Kleter et al. (1998) JCM
SPF10	SPF2	GCAAGTGTGATCTACTTGGCTG	L1	—	—	—	—
FAP59/FAP64	FAP59	TAACWGTIGGICAYCCWTATT	L1	480 bp	Cutaneous Beta-HPVs	Beta-HPV detection in dermatological studies; EV research	Favre et al. (2000)
FAP59/FAP64	FAP64	CCWATATCWVHCATITCICCATC	L1	—	—	—	—
CPI/CPIIG	CP-I	TTTTGTGGCCDTGCTATCT	L1	459 bp	Broad spectrum (skin/mucosal)	Broad spectrum; research and clinical	Coutlee et al. (2002)
CPI/CPIIG	CP-II+G	GAAAAATAAACTGTAAATCATATTC	L1	—	—	—	—
E7-F/E7-R (HPV16)	E7-F	ATGAAATAGATGGTCCAGC	E7	~400 bp	HPV16 specific	Quantification/sequencing of HPV16 E7	Type-specific refs
E7-F/E7-R (HPV16)	E7-R	TGGTTTCTGAGAACAGATGG	E7	—	—	—	—
E6-sense/E6-antisense (HPV16)	E6-sense	ATGCACCAAAAGAGAACTGCAATG	E6	~200 bp	HPV16 specific	Type-specific PCR for HPV16	Yamada et al. (1995)
E6-sense/E6-antisense (HPV16)	E6-antisense	CTTCTGGCTTCTGCCATGTTTCA	E6	—	—	—	—
E6-F/E6-R (HPV18)	HPV18 E6-F	ATGCACCTAAAGAAACTGCAATG	E6	~200 bp	HPV18 specific	Type-specific PCR for HPV18	Muñoz N et al. (2003) NEJM
E6-F/E6-R (HPV18)	HPV18 E6-R	GTACAGCTGGGAATCTGTGTT	E6	—	—	—	—
HPVE7F/HPVE7R (HPV18)	HPV18 E7-F	ATGCATGGAGATACACCTACATTG	E7	~300 bp	HPV18 specific	HPV18 E7 detection	Multiple refs
HPVE7F/HPVE7R (HPV18)	HPV18 E7-R	AACAAATGGTCCAGCTGGCTTTTG	E7	—	—	—	—
LCR-F/LCR-R (HPV16 lineage)	LCR-F	GGGCAGTGGTGGAATGCAAATAGA	LCR/E6	~580 bp	HPV16 lineage typing	HPV16 variant classification/lineage typing	Yamada T et al. HPV lineage papers
LCR-F/LCR-R (HPV16 lineage)	LCR-R	CCTATAAATCCTGATGCTGATAAATAG	LCR/E6	—	—	—	—
INNO-LiPA SPF10	SPF1c-biotin	CCTTGTTRCAYGGGGCNGT	L1	65 bp	Wide spectrum (INNO-LiPA)	INNO-LiPA HPV Genotyping Extra assay	Van Doorn LJ et al. (2001)
INNO-LiPA SPF10	SPF2-biotin	GCAAGTGTGATCTACTTGGCTG	L1	—	—	—	—

DNA vs. RNA-Based Assays — Clinical Implications for HPV Surveillance

DNA-Based Assays

Target: L1 ORF, E6/E7, E1 genomic DNA
Detect HPV regardless of transcriptional activity (latent + active infections)
May detect clinically irrelevant transient or cleared infections
Examples: HC2, cobas, Linear Array, INNO-LiPA, Anyplex 28, Allplex 28
Higher sensitivity; lower specificity for clinically active transforming infection
Risk classification applies at genotype level — requires IARC 100B reference
VALGENT-validated DNA tests: cobas, Abbott RealTime, BD Onclarity, HC2, APTIMA, Anyplex II

RNA-Based Assays (mRNA)

Target: E6/E7 mRNA — active oncogenic transcription only
Indicates clinically active, potentially transforming infection
Higher specificity; better positive predictive value (PPV) for CIN2+
Example: APTIMA HPV (Hologic) — TMA method; FDA-approved
Slightly lower sensitivity than DNA assays; may miss early infections
IARC risk classification still applies — mRNA detection of Group 2B types still requires correct labelling
Less suitable for broad-spectrum surveillance due to lower sensitivity for non-transforming types

HPV Vaccines, Antibodies & Therapeutics

Approved prophylactic vaccines, global deployment, antibody responses, and emerging therapeutic strategies.

WHO Cervical Cancer Elimination Strategy (2020): Target — 90% of girls vaccinated by age 15; 70% of women screened by age 35 and 45; 90% treated. See latest 2025 global data ↗

Approved HPV Prophylactic Vaccines — Global Comparison

Vaccine	Manufacturer	Valence	HPV Types	Technology	Dosing	Age Target	Regions
Gardasil 9 (9vHPV)	Merck	9-valent	6,11,16,18,31,33,45,52,58	L1 VLP (yeast)	2 doses (9-14y); 3 doses (≥15y)	9-45 yrs	100+ countries — current gold standard
Cervarix (2vHPV)	GSK	2-valent	16,18	L1 VLP + AS04 adjuvant	2 doses (9-14y)	9-25 yrs	UK, EU, Africa, Asia — widely used in LMIC
Cecolin (2vHPV)	Innovax (China)	2-valent	16,18	L1 VLP (E. coli)	2 doses	9-45 yrs	China; WHO prequalified 2021; lower cost option
Gardasil 4 (qHPV)	Merck	4-valent	6,11,16,18	L1 VLP (yeast)	2-3 doses	9-45 yrs	Being phased out in favour of 9-valent
Walrinvax (9vHPV)	Walvax (China)	9-valent	6,11,16,18,31,33,45,52,58	L1 VLP	3 doses	9-45 yrs	China (approved 2024)

Global Vaccination Coverage by Region

🌍 Sub-Saharan Africa

Cervarix dominant. Gardasil 9 expanding via GAVI. South Africa transitioning to 9vHPV. Cecolin offering cost-effective option.

🌎 Americas

Gardasil 9 standard in USA, Canada, Brazil. Many Latin American countries use 2v/4v via PAHO. Gender-neutral vaccination expanding.

🌏 Asia-Pacific

Japan, Australia: Gardasil 9. China: multiple vaccines. India: Cervavac (Serum Institute 4vHPV). HPV52/58 disproportionate in East Asia.

🌍 Europe

Gardasil 9 dominant. UK pioneered single-dose HPV programme (2023). Strong immunogenicity data support one-dose regimen.

Therapeutic Strategies — Current & Emerging

Important: Current licensed HPV vaccines are prophylactic only — they do NOT treat existing HPV infection. Therapeutic vaccines targeting E6/E7 are in clinical development.

🎯 Therapeutic Vaccines (E6/E7)

ISA101 (HPV16 E6/E7 synthetic long peptides) showed responses in CIN2/3 (Kenter GG et al., 2009 NEJM). DNA vaccines, peptide vaccines, mRNA approaches in Phase I-II trials.

🛡 Immune Checkpoint Inhibitors

Pembrolizumab (anti-PD-1) approved for HPV+ cervical cancer (2nd line). KEYNOTE-826: chemoradiation + pembrolizumab for locally advanced disease (2021).

🧬 CRISPR-Based Approaches

CRISPR/Cas9 targeting HPV16/18 E6/E7 ORFs. Complete elimination from cervical cancer cell lines in preclinical studies. Early clinical trials in China targeting CIN2/3.

💉 CAR-T Cell Therapy

E6/E7-specific TCR-T cells (HPV16 E7) — Phase I trials (NCI, Hinrichs CS et al., 2022 Science). Objective responses in heavily pre-treated cervical cancer patients.

HPV Interactome

From infection epidemiology to co-detection pairs to network science: a unified view of HPV genotype interactions.

HPV Infection Prevalence by Pattern — Multi-Study Comparison

Single vs. Multiple Infection Prevalence Across Key Studies

Study / Data Source	Population	Region	Single Infection	Multiple Infection	PMCID / DOI
Zeng et al. 2025 (S. China, n=196,103)	General Women	East Asia	82.1%	17.9%	PMC12522608
Chengdu Study 2025 (n=51,556)	Gynecol Outpatients	East Asia	60.6%	39.4%	Front2025
Yangpu Shanghai 2025 (n=19,142)	Gynecol Outpatients	East Asia	71.3%	28.7%	PMC12232720
Fan et al. 2020 (China 8 cities, n=137,943)	Gynecol Outpatients	East Asia	74.2%	25.8%	PMC7154087
Chaturvedi et al. 2011 (Costa Rica CVT, n=5,871)	Young Women 18-25y	Latin America	56.8%	43.2%	PMC3068034
BMC Infect Dis 2023 (Sichuan, n=20,059)	Screened Women	East Asia	75.3%	24.7%	SpringerBMC2023
FSW Meta-analysis 2020 (n=21,402 FSW)	Female Sex Workers	Global	57.4%	42.6%	BMCPubHealth2020
Men Global 2023 (n=44,769 men)	General Men	Global	69%	31%	LancetGH2023

HPV Infection Patterns by Population, Sex, Age & HIV Status

General Women (Global estimates)

11.7%

Any HPV

9.5%

HR-HPV

22%

Multi-type

WHO/ICO HPVcentre global estimates

Women with HIV (Global estimates)

45%

Any HPV

40%

HR-HPV

45%

Multi-type

Stelzle et al. 2025 JID; PWH burden review

HIV+ MSM (Anal; Tianjin 2024)

62%

Any HPV

50%

HR-HPV

35%

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Anal; Tianjin 2024)

53.7%

Any HPV

38%

HR-HPV

28%

Multi-type

Front PubHealth 2024 (Tianjin China)

Female Sex Workers (Pooled global meta-analysis)

42.6%

Any HPV

28%

HR-HPV

40%

Multi-type

BMC PubHealth 2020 meta-analysis (n=21,402; 62 studies)

MSW/Heterosexual Men (Tianjin 2024)

8.3%

Any HPV

5.5%

HR-HPV

Multi-type

Front PubHealth 2024 (Tianjin China)

HIV- MSM (Multi-site; Gardasil trial)

48%

Any HPV

35%

HR-HPV

28%

Multi-type

PMC3086446 (Gardasil trial MSM)

General Men (Global meta-analysis)

31%

Any HPV

21%

HR-HPV

—

Multi-type

Lancet GH 2023 meta-analysis (n=44,769; 65 studies)

HPV Prevalence by Region & Population Type — Key Data Points

Region	Population	Any HPV (%)	HR-HPV (%)	Multiple Infections (%)	Notable Genotypes	Reference
East Asia (China)	General women	11–23%	9–17%	18–28%	HPV52, HPV16, HPV58	Fan 2020; Zeng 2025
Latin America	Young women 18–25y	42% HPV+	—	43%	HPV51, HPV52, HPV16	CVT Chaturvedi 2011 JID
Sub-Saharan Africa	HIV+ women	65–85%	55–75%	40–55%	HPV16, HPV35, HPV18, HPV45	Stelzle et al. 2025 JID
Global (MSM)	MSM HIV+	62–83%	50–70%	35–55%	HPV16, HPV6/11, HPV52, HPV58	Front PubHealth 2024
Global (FSW)	Female sex workers	42.6% (pooled)	28%	40%	HPV16, HPV52, HPV18	BMC PubHealth 2020 meta
Global (Men)	General men	31%	21%	~25%	HPV16, HPV6	Lancet GH 2023 meta
South Asia (India)	FSW+MSM+IDU	69–73%	25%	—	HPV16, HPV18	PubMed 22631651
Europe (Spain)	Gynecol. outpatients	17–25%	14–17%	20–30%	HPV16, HPV31, HPV58	BMC Infect Dis 2009

Most Frequent Co-Detection Pairs — Evidence Base for Network Edges

Co-detection frequency relative prevalence within HPV+ co-infected samples | Citations from peer-reviewed studies

HPV52+HPV53

East Asia

52%

Most frequent pair in Southern China (n=196,103); HPV53 probable HR-HPV; Zeng et al. 2025 Virol J [PMC12522608]

Zeng et al. 2025 Virol J (PMC12522608)

HPV52+HPV58

East/SE Asia

48%

Pan-regional; dominant in East & SE Asia; Alpha-9 cluster synergy; Zeng 2025; BMC Infect Dis 2023

Zeng 2025; BMC Infect Dis 2023

HPV52+HPV16

East Asia

45%

Top pair in Chengdu (n=51,556; 106 cases) & BMC Infect Dis (51 cases); both Alpha-9 HR-HPVs

Frontiers PubHealth 2025; BMC Infect Dis 2023

HPV51+HPV52

Latin America

52%

Most frequent combination in Mexico City (51.93%); Alpha-5+Alpha-9 cross-genus; BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV16+HPV31

East Asia

38%

3.5x higher than expected by chance; Alpha-9 phylogenetic affinity; Fan et al. 2020 Front Oncol [PMC7154087]

Fan et al. 2020 Front Oncol (PMC7154087)

HPV18+HPV31

East Asia

43%

4.3x higher than expected by chance; highest OR in China 137k nationwide study; Fan et al. 2020

Fan et al. 2020 Front Oncol

HPV58+HPV33

East Asia

43%

Second most frequent in Shanghai (12.9%); both Alpha-9; Cambridge Epidemiol Infect 2015

Cambridge Epidemiol Infect 2015

HPV16+HPV18

Global

45%

Highest combined cancer risk; E6/E7 dual oncogenesis; both IARC Group 1 HR-HPVs

Multiple global studies

HPV16+HPV33

Europe/Lat Am

35%

Alpha-9 cluster; frequent in Mexico & Spain; both HR-HPV; BMC Cancer 2017; BMC Infect Dis 2009

BMC Cancer 2017; BMC Infect Dis 2009

HPV16+HPV51

East Asia

35%

Common in Chengdu (70 cases) and MSM cohorts; Alpha-9 intra-cluster; Front Public Health 2025

Frontiers PubHealth 2025

HPV16+HPV58

East Asia

32%

Frequent in Chengdu (68 cases) & Asia-Pacific; both Alpha-9 HR; Chengdu study 2025

Frontiers PubHealth 2025 (Chengdu)

HPV18+HPV45

Global

28%

Adenocarcinoma-associated pair; both Alpha-7; glandular lesion tropism

IARC/WHO classification studies

HPV52+HPV39

East Asia

28%

BMC Infect Dis 2023 (Sichuan): 35 cases; cross-species Alpha-9+Alpha-5; co-infection HSIL risk OR 3.18

BMC Infect Dis 2023 (Sichuan)

HPV31+HPV33

Global

25%

Alpha-9 intra-cluster; squamous lesion association; CIN2+ in multiple populations globally

Chaturvedi 2011 JID (PMC3068034)

HPV6+HPV11

Global

82%

Strongest benign co-detection pair (82%); both Alpha-10; anogenital warts; no malignant potential

Chaturvedi 2011 JID (PMC3068034)

HPV16+HPV6

Latin America

32%

LR+HR mixed; HPV6 facilitates HPV16 co-infection; BMC Cancer Mexico 2017 (p<0.001)

BMC Cancer 2017 (Mexico City)

HPV53+HPV66

Global

22%

Both probable HR-HPV; HPV53 Group 2B IARC; emerging pair in surveillance data worldwide

Surveillance data; IARC Group 2B

HPV35+HPV16

Latin America

18%

HPV35 specifically co-infects with HPV16 and HPV6 but not HPV51/52; Mexico BMC Cancer 2017

BMC Cancer 2017 (Mexico City)

HPV45+HPV16

Global

18%

Both Alpha-7; adenocarcinoma cluster; HPV45 frequently accompanies HPV16 in glandular lesions

Multiple adenocarcinoma studies

HPV82+HPV16

Global

15%

HPV82 Group 2B; co-detection with HPV16 in high-grade lesions; supports IARC reclassification

IARC/high-grade lesion studies

HPV Type Co-infection Preference — Preferred & Avoided Partners

HPV Type	Preferred Co-infectors (OR)	Avoidance	Lesion Context	Reference
HPV16	HPV31 (3.5x), HPV33 (3.1x), HPV51 (2.8x), HPV58 (2.5x)	HPV52 (low OR)	CIN1-3, ICC (dominant)	Fan 2020; CVT Chaturvedi 2011
HPV18	HPV31 (4.3x), HPV51 (3.2x), HPV33 (2.9x), HPV52 (1.9x)	HPV58 (low OR)	Adenocarcinoma, CIN2+	Fan 2020 Front Oncol
HPV52	HPV53 (4.1x), HPV58 (3.8x), HPV16 (3.2x), HPV51 (2.9x), HPV39 (2.5x)	—	CIN1-2, Asian populations	Zeng 2025; BMC Infect Dis 2023
HPV51	HPV52 (5.2x), HPV16 (2.8x), HPV56 (2.2x)	—	CIN1-2, multiple regions	BMC Cancer 2017 (Mexico)
HPV6	HPV11 (>10x), HPV16 (2.4x), HPV33 (2.2x)	—	Genital warts	Chaturvedi 2011 JID
HPV31	HPV16 (3.5x), HPV18 (4.3x), HPV33 (2.8x)	—	CIN1-3	Fan 2020 Front Oncol
HPV58	HPV33 (4.2x), HPV52 (3.8x), HPV16 (2.5x), HPV31 (2.2x)	—	CIN2+, Asian pop	Cambridge 2015; Chengdu 2025
HPV33	HPV58 (4.2x), HPV16 (3.1x), HPV6 (2.2x), HPV51 (2.0x)	HPV52 (low)	CIN1-3	Cambridge 2015; Fan 2020

HPV Co-occurrence Network — Interactome Visualisation

High-Risk

Low-Risk

Benign

Network Science — Interpretation & Research Applications

Hub Node Analysis

Cluster Topology

Misclassification Detection

Type Replacement Risk

HPV Conferences 2021-2026

International HPV conferences: IPVC, EUROGIN, ESPVS, and related scientific meetings.

Key conference series: The International Papillomavirus Conference (IPVC) is the premier global HPV science meeting, held biennially. EUROGIN focuses on European HPV prevention guidelines. ESPVS focuses on basic virology and evolutionary biology.

Upcoming Conferences

36th International Papillomavirus Conference (IPVC 2026) — Planned

2026 | 2026

TBD (Biennial)

Global elimination progress review

Expected: TBD: Expected to focus on elimination milestones

EUROGIN 2026 — Planned

2026 | 2026

TBD

European progress review

Expected: TBD

Past Conferences (2021-2025)

EUROGIN 2025

2025 | June 2025

Amsterdam, Netherlands

European elimination targets, gender-neutral vaccination

Self-sampling HPV tests; gender-neutral programs

https://www.eurogin.com

35th International Papillomavirus Conference (IPVC 2025)

2025 | Sept 2025

Chicago, USA

Next-generation vaccines, HPV network science, AI in diagnostics

AI-assisted HPV diagnostics; next-gen 14-valent vaccine trials; global elimination progress

https://www.ipvc2025.org/

ASCO 2024 — HPV-associated Cancers Sessions

2024 | June 2024

Chicago, USA

HPV-associated head & neck cancer, cervical cancer trials

Pembrolizumab + chemoradiation for HPV+ cancers; HPV ctDNA monitoring

https://www.asco.org/

EUROGIN 2024

2024 | June 2024

Valencia, Spain

HPV16 variant data, cervical cancer in Europe

Updated HPV16/18 variant carcinogenic data; EUROGIN screening guidelines

https://www.eurogin.com

34th International Papillomavirus Conference (IPVC 2024)

2024 | Sept 9–12, 2024

Sydney, Australia

Pacific/Asia-Pacific HPV epidemiology, lineage studies

HPV16 lineage B carcinogenicity; Asia-Pacific epidemiology; network science in HPV research

https://ipvc2024.org/

ESPVS 2023 Annual Meeting

2023 | Oct 2023

Amsterdam, Netherlands

HPV viral evolution, variant biology

Evolution of Beta-HPV; MuPV characterisation

https://www.espvs.org/

EUROGIN 2023

2023 | June 2023

Athens, Greece

European cancer prevention strategies

EU-wide elimination strategies; novel biomarker research

https://www.eurogin.com

33rd International Papillomavirus Conference (IPVC 2023)

2023 | Sept 4–7, 2023

Rome, Italy

HPV virology, cancer biology, network science approaches

HPV evolutionary biology; new variant data for HPV16/18/58; network interactome science

https://ipvc2023.com/

USCAP 2022 — HPV-related Pathology Sessions

2022 | March 2022

Multiple sites, USA

HPV-associated pathology advances

HPV-related head and neck pathology classification updates

https://www.uscap.org/

EUROGIN 2022

2022 | June 2022

Geneva, Switzerland

European guidelines, vaccine effectiveness data

Post-pandemic catch-up vaccination; cervical cancer elimination in Europe

https://www.eurogin.com

32nd International Papillomavirus Conference (IPVC 2022)

2022 | Sept 22–25, 2022

Washington D.C., USA

Elimination of cervical cancer, new vaccine data, co-infections

WHO 90-70-90 targets progress; 9-valent vaccine global rollout data; one-dose vaccine trial results

https://www.hpv2022.org/

EUROGIN 2021

2021 | Sept 2021

Virtual

Cervical cancer elimination, vaccination strategies

Vaccine-based elimination strategies; MSM vaccination recommendations

https://www.eurogin.com

31st International Papillomavirus Conference (IPVC 2021)

2021 | April 2021

Virtual (COVID-19 impact)

HPV vaccines, epidemiology, COVID-19 disruptions to screening

First virtual IPVC; HPV vaccine equity discussions; COVID-19's impact on HPV screening coverage

https://www.hpv2021.org/

Conference Activity Timeline

Research Blog

HPV research analyses, network plots, and findings from KP Analytics Insights.

To submit posts, use the Shiny app version on ShinyApps.io. This static RPubs version shows existing posts. Contact: kpinsights@proton.me

Welcome to HPV Reference Center v2.0

📅 2025-08-27 · 👤 Keletso Phohlo · KP Analytics Insights

Welcome Introduction

Welcome to the HPV Reference Center v2.0 — a comprehensive, evidence-based, open-access platform for HPV researchers, virologists, clinicians, and public health professionals.

Built by KP Analytics Insights (PTY) Ltd · East London, Eastern Cape, South Africa · kpinsights@proton.me

HPV16 Lineage B — Why African Lineages Matter for Cancer Risk

📅 2025-06-14 · 👤 Keletso Phohlo

HPV16 Lineages Africa Carcinogenesis

HPV16 Lineage B (African-1) is significantly more carcinogenic than the globally dominant Lineage A. E6 amino acid substitution L83V in Lineage A vs. R10G/D25E in Lineage B alter p53 degradation efficiency. Lineage B is enriched in Southern African populations, making lineage-aware typing critical for regional cervical cancer prevention strategies.

HPV Co-occurrence Interactome — Network Science Approach

📅 2026-03-01 · 👤 Keletso Phohlo

Network Interactome visNetwork Co-occurrence

Interactive visNetwork HPV co-occurrence interactome — HPV16 as the dominant hub, HPV6/11 strong benign cluster (0.82 edge weight), HPV52/58 Asia-Pacific cluster. Available on RPubs ↗.

Researcher Profile — Keletso Phohlo

Medical science, Biostatistics, Boinformatics, and Cytopathology.

👨‍🔬

Keletso Phohlo

Medical Biological Scientist · Biostatistician · Cytologist

KP Analytics Insights (PTY) Ltd · Butterworth, Eastern Cape, South Africa

Interactive Network Plots ResearchGate ORCID 0000-0002-9413-5672 kpinsights@proton.me

Research Focus

Primary Focus

HPV Genotype Co-occurrence Networks, HIV Drug Resistance Mutation Surveillance

Methods

R programming, Molecular Laboratory Assays

Data Science

Complex Network topology Analyais, Infectious Disease Data Analysis

Epidemiology

HPV, HIV and STIs surveillance, globally

Diagnostics

HPV genotyping, HIV Drug Resistance Detection, Molecular Assay Comparison

Platform

KPAI, UCT, NHLS, NMAL/WSU, DGMAL/SMU, WITS

Interactive Network Research — RPubs Portfolio

Keletso's interactive HPV network plots are published on RPubs using the visNetwork package in R. These dynamic, interactive visualisations allow users to explore HPV genotype co-occurrence networks, identify hub nodes (e.g. HPV16, HPV6/11 cluster), and examine edge weights (co-detection frequencies) — the same methodology powering this reference centre's Interactome page.

🌐

HPV Co-occurrence Network Visualisations

Interactive visNetwork-based HPV genotype interactome plots — fully dynamic, zoomable, and explorable

View Interactive Network Plots on RPubs

Academic & Professional Profiles

ResearchGate

Keletso Phohlo

Full publication list, research metrics, collaboration network, and co-authorship data

Open Profile

ORCID

0000-0002-9413-5672

Persistent digital identifier for research output attribution and publication history

Open Profile

RPubs — Interactive Work

Keletso_Phohlo

Interactive visNetwork HPV co-occurrence plots, R Shiny dashboards, and network analyses

Open Profile

Direct Contact

kpinsights@proton.me

Research collaborations, data requests, consultancy enquiries — KP Analytics Insights (PTY) Ltd

Open Profile

HPV & Co-infections: BV, STIs & the Genital Microenvironment

The complex interplay between HPV, bacterial vaginosis, HIV, HSV-2, Chlamydia, and other sexually transmitted infections — epidemiology, biological mechanisms, and clinical implications.

Highlighted Research — KP Analytics Insights: Taku O, Brink A, Phohlo K et al. (2021). Detection of sexually transmitted pathogens and co-infection with HPV in women residing in rural Eastern Cape, South Africa. PeerJ 9:e10793 ↗ — This landmark study from the Eastern Cape demonstrated that STI co-infections are highly prevalent among HPV-positive women in rural settings, with significant implications for cervical cancer risk.

Why Co-infections Matter — The Biological Case

🦠

Microbiome Disruption

BV disrupts Lactobacillus-dominant vaginal flora → alkaline pH → increased HPV persistence and susceptibility to other STIs

🔥

Inflammatory Synergy

STI-induced cervicitis/vaginitis creates pro-inflammatory cytokine milieu (IL-6, TNF-α, IL-8) → promotes HPV integration and carcinogenic progression

📊

Epidemiological Amplification

Co-infection prevalence in sub-Saharan Africa: HPV + BV (35–55%); HPV + CT (20–30%); HPV + HIV (85%+ in HIV+ women)

Bacterial Vaginosis (BV) and HPV: The Most Clinically Significant Synergistic Interaction

Vaginal dysbiosis, characterized by Gardnerella dominance, is the primary microbial landscape associated with HPV worldwide. This state is not a passive bystander; it is a metabolic and structural driver that promotes the stability of the HPV interactome, thereby fueling viral persistence and the transition to malignancy.Refs: PMC9257898 ↗ | MDPI Microbiol 2025 ↗

🔬 Mechanistic Links: BV → HPV Pathogenesis

pH elevation: BV-associated bacteria produce biogenic amines (putrescine, cadaverine) → vaginal pH ≥4.5 → inactivates H₂O₂ (natural HPV virucide produced by Lactobacillus spp.)
Sialidase activity: BV bacteria (Prevotella bivia, Mobiluncus spp.) produce sialidase → degrades cervical mucus barrier → increased HPV access to epithelial cells
NF-κB activation: BV LPS activates NF-κB → upregulates AP-1 binding sites in HPV LCR → enhanced E6/E7 transcription
IL-6/IL-8 milieu: BV-associated cytokine storm → Th2-skewed immune response → reduced CTL-mediated clearance of HPV-infected cells
Epithelial disruption: BV reduces tight junction protein expression (claudin-1, ZO-1) → facilitates HPV virion entry into basal cells

📈 Epidemiological Evidence

HR-HPV persistence: BV co-occurrence increases HR-HPV persistence odds by 2.0–3.8× (OR) across African and Asian cohorts
CIN2+ risk: BV + HR-HPV confers significantly higher CIN2+ risk than HPV alone (meta-analysis: RR ~1.7)
Lactobacillus-deficient microbiome: Women with L. iners-dominant (vs. L. crispatus-dominant) microbiome have 2.5× higher HPV acquisition rate
Eastern Cape data: In rural SA, BV prevalence in HPV+ women = 52.3% vs. 31.7% in HPV-negative women (Taku et al. 2021 PeerJ)
Ref: ScienceDirect (Virol. J. 2022) ↗

HPV Co-infection Profile — Key STIs & BV

Co-infection	Mechanism of HPV Interaction	Prevalence (Sub-Saharan Africa)	Effect on HPV Outcome	Key Reference
Bacterial Vaginosis (BV)	Sialidase, pH elevation, NF-κB activation, mucus barrier disruption	35–55% in HPV+ women	↑ HR-HPV persistence (OR 2.0–3.8); ↑ CIN2+ risk; disrupted local immunity	Taku et al. (2021) PeerJ 9:e10793 ↗
HIV-1	CD4+ T-cell depletion; immune dysregulation; HAART incomplete restoration	85–95% in HIV+ women have concurrent HPV	↑ HPV persistence; ↑ multi-type infection; ↑ HR-HPV prevalence; ↑ CIN3/ICC risk 5–10×	Menezes LJ et al. (2019) Sex Transm Infect PMC6561095 ↗
Chlamydia trachomatis (CT)	Endocervical cell invasion; inflammatory cytokines; TLR-mediated immune evasion	15–25% of HPV+ women (SA)	↑ HR-HPV acquisition; synergistic inflammatory microenvironment; CT LPS upregulates HPV LCR	Taku et al. (2021) PeerJ; Taku et al. (2021) PeerJ ↗
Herpes Simplex Virus-2 (HSV-2)	Epithelial barrier disruption; recruitment of HIV/HPV target cells; immune dysregulation	22–45% in HPV+ women (SSA)	↑ HPV acquisition (disrupted mucosa); ↑ CIN2+ in dual-infected women	Menezes et al. (2019) Sex Transm Infect ↗
Trichomonas vaginalis (TV)	Cytopathic effect on epithelium; inflammation; complement activation	10–20% (SA rural communities)	↑ HPV detection rates; pro-inflammatory milieu; possible co-receptor role	Taku et al. (2021) PeerJ ↗
Neisseria gonorrhoeae (GC)	Cervical inflammation; mucopurulent discharge disrupts cervical mucus	5–15% in symptomatic women	Synergistic cervicitis; ↑ HIV/HPV acquisition	IJID (2018) ↗
Mycoplasma genitalium	TLR2/4 activation; NF-κB; IL-6/IL-8 induction	8–20% in HPV+ women	↑ Cervicitis severity; potential HPV persistence modifier	Taku et al. (2021) PeerJ 9:e10793 ↗
Treponema pallidum (Syphilis)	Ulceration provides direct epithelial access; immune dysregulation	1–8% (varies by region/risk)	Mucosal ulcers ↑ HPV acquisition; co-treatment essential	IJID (2018); Menezes et al. (2019) ↗

African Context — HPV & STI Co-infections in Sub-Saharan Africa

Sub-Saharan Africa bears a disproportionate burden of both HPV-related cervical cancer and STIs/BV. The convergence of high HIV prevalence, BV prevalence, STI burden, and limited screening access creates a perfect storm for HPV-driven carcinogenesis. Research from the Eastern Cape, Western Cape, and Nigeria provides critical regional data. Refs: Taku et al. (2021) PeerJ ↗ | Menezes et al. (2019) Sex Transm Infect ↗ | PubMed 40007002 ↗

HPV prevalence in HIV+ SA women

~85–95%

BV + HPV co-infection (rural EC)

~52%

Multi-type HPV + STI (SA)

~35–45%

Key African studies:
1. Taku O, Brink A, Phohlo K et al. (2021). Detection of sexually transmitted pathogens and co-infection with HPV in women in rural Eastern Cape, South Africa. PeerJ 9:e10793. doi:10.7717/peerj.10793 ↗
2. Menezes LJ, Pokharel U, Sudenga SL et al. (2019). Patterns of prevalent HPV and STI coinfections in HIV-negative young Western Cape women: The EVRI Trial. Sex Transm Infect 94(1):55–61 ↗
3. HPV & BV interactions (medRxiv 2024 preprint) ↗ | PLOS ONE 2024 ↗

Additional Clinical & Biotechnology References

Advances in HPV biotechnology (IJS 2024)
Recent advances covering HPV co-infection diagnostics, multiplex STI panel testing, and point-of-care platforms for resource-limited settings.
https://journals.lww.com/international-journal-of-surgery/fulltext/2024/12000/recent_advances_in_hpv_biotechnology_.56.aspx ↗

HPV and Vaginal Microbiome Review (Virol. J. 2022)
Mechanistic review of how Lactobacillus-deficient vaginal microbiome (BV phenotype) promotes HPV persistence and cancer risk.
https://www.sciencedirect.com/science/article/pii/S2352578922000236 ↗

HPV-BV metagenomics (medRxiv 2024)
Metagenomic investigation of vaginal microbiome in HPV+ women — describing microbial community shifts and their relationship to HPV lineage persistence.
https://www.medrxiv.org/content/10.1101/2024.01.28.24301891v1 ↗

STI-HPV Network Analysis (PLOS ONE 2024)
Network analysis of STI co-occurrence patterns in HPV-infected women.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0307781 ↗

Vaginal Microbiome & HPV Clearance (MDPI 2025)
Updated review on how vaginal microbiome composition determines HPV acquisition, persistence and regression.
https://www.mdpi.com/2673-3986/6/4/79 ↗

PMC9257898 — HPV & STI Co-infections
Comprehensive multi-site study of HPV and STI co-infections in African populations.
https://pmc.ncbi.nlm.nih.gov/articles/PMC9257898/ ↗

IJID 2018 — STI Co-infections
Multi-pathogen co-infection patterns in HPV-positive women in southern Africa.
https://www.ijidonline.com/article/S1201-9712(18)34435-7/fulltext ↗

HPV Databases & Bioinformatics Resources

Authoritative online databases for papillomavirus sequences, genomics, taxonomy, and bioinformatics analysis.

PaVE — Papillomavirus Episteme

pave.niaid.nih.gov

Open ↗

The definitive papillomavirus sequence database, hosted by NIAID/NIH. Contains complete annotated genomes for all officially classified PV types. Updated with each ICTV classification cycle.

Complete genome sequences for all classified PV types (400+)
Annotated ORFs: E1, E2, E4, E5, E6, E7, L1, L2, LCR
Protein sequences, functional domain annotations
BLAST search against all PV genomes
Alignment tools: generate multiple sequence alignments
Phylogenetic tree construction
Download sequences in FASTA, GenBank format
Reference: Van Doorslaer K et al. (2017) Nucleic Acids Res 45(D1):D499–D506

Papillomavirus Episteme (PaVE) — 2017 Update

NAR Database Issue 2017

Open ↗

The 2017 major update to PaVE (Nucleic Acids Research Database Issue) describing expanded genome coverage and new analytical tools.

Expanded to cover genomes from all PV families (human, animal, bird)
Added lineage and variant annotation system
New BLAST implementation with papillomavirus-specific scoring matrices
Integration with NCBI databases (GenBank, RefSeq)
Visualisation of genome organisation per type
Access to complete proteome and nucleotide data
DOI: 10.1093/nar/gkw879

HPV Information Centre (ICO/IARC)

hpvcentre.net

Open ↗

Epidemiological data on HPV prevalence, vaccination coverage, cervical cancer incidence/mortality by country. Run by the Catalan Institute of Oncology (ICO) and IARC.

Country-specific HPV prevalence estimates
Cervical cancer incidence and mortality statistics by country
Vaccination coverage data globally
Summary reports for 172 countries
Data stratified by age, HIV status, cytology
Cervical cancer burden attributable to specific HPV genotypes
WHO pre-qualification status and vaccine schedules

ICTV — Papillomaviridae Report

ictv.global

Open ↗

The International Committee on Taxonomy of Viruses official classification and nomenclature for all Papillomaviridae genera, species, and types.

Official genus, species, and type classifications
Criteria for type, sub-type, and variant designation (>10% / 2–10% / <2% L1 divergence)
ICTV Master Species List downloadable
Two sub-families: Firstpapillomavirinae, Secondpapillomavirinae
All genera descriptions (Alpha through Omicron and beyond)
Nomenclature committee reports and ratification documents

NCBI PapillomaVirus (PapillomasDB)

ncbi.nlm.nih.gov

Open ↗

NCBI GenBank virus genome database for all papillomaviruses, with links to RefSeq complete genomes and PubMed literature.

All deposited PV genome sequences (not just ICTV-classified)
Candidate novel types awaiting official classification
Metagenomic-derived PV partial sequences
Link to PubMed literature per genome
BLAST against all PV genomes
Download RefSeq reference genomes

UniProt — HPV Proteomes

uniprot.org

Open ↗

Comprehensive protein sequence and functional annotation database. Contains complete proteomes for all classified HPV types — E1, E2, E4, E5, E6, E7, L1, L2 with domain annotations.

Protein sequences for all HPV ORFs
Functional domain annotations (PDZ-binding motif, LxCxE, LXXLL)
Post-translational modification sites
3D structure links (AlphaFold/PDB)
Protein interaction networks
E6/E7 functional variant annotations
Cross-references to PaVE, ICTV, PubMed

HPV Lineage Database (Chen Z lab)

NCBI Nucleotide

Open ↗

NCBI GenBank repository of HPV lineage and variant sequences deposited by Chen Z, Mirabello L, and collaborators. Provides the reference sequences for HPV16 (lineages A–D), HPV18, HPV33, HPV45, HPV52, HPV58.

Reference sequences for all named HPV16 lineages (A1–A4, B1–B2, C, D1–D3)
HPV18 lineage reference sequences (A, B, C)
HPV33, HPV45, HPV52, HPV58 variant sequences
Aligned complete genome files
Search by HPV type + 'variant' or 'lineage' in NCBI Nucleotide

ResearchGate — HPV Genomics (SA)

ResearchGate 2019

Open ↗

Discovery and characterisation of six novel Gammapapillomavirus types from penile swabs collected in South Africa — expanding the catalogue of Gamma-PVs in the African context.

6 novel Gamma-PV types from South African penile swab samples
Whole genome sequences submitted to GenBank
Phylogenetic placement within Gammapapillomavirus genus
Genomic characterisation: ORF annotation, LCR structure
Demonstrates Africa as a rich source of novel PV types
Direct relevance to Gamma-PV diversity in sub-Saharan Africa

Complete Bibliography

All references cited in the HPV Reference Center — formatted in Vancouver citation style as used in HPV research publications.

References are formatted in Vancouver style (numeric, used in PubMed/MEDLINE and the majority of HPV virology and infectious disease journals). Click any hyperlinked title to open the source.

Taxonomy & Classification

de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H. Classification of papillomaviruses. Virology. 2004;324(1):17–27. doi:10.1016/j.virol.2004.03.033

Bernard HU, Burk RD, Chen Z, van Doorslaer K, zur Hausen H, de Villiers EM. Classification and nomenclature of all human papillomaviruses. Virology. 2010;401(1):70–79. doi:10.1016/j.virol.2010.02.002

Van Doorslaer K, Li Z, Xirasagar S et al. The Papillomavirus Episteme: a major update to the papillomavirus sequence database. Nucleic Acids Res. 2017;45(D1):D499–D506. doi:10.1093/nar/gkw879

Hošnjak L, Kocjan BJ, Pirš B, Seme K, Poljak M. The genetic diversity of human papillomavirus types from the species Gammapapillomavirus 15: HPV135, HPV146, and HPV179. PLOS ONE. 2021;16(5):e0249829. doi:10.1371/journal.pone.0249829

Epidemiology & Risk Classification

Muñoz N, Bosch FX, de Sanjosé S et al. Epidemiological classification of human papillomavirus types associated with cervical cancer. N Engl J Med. 2003;348(6):518–527. doi:10.1056/NEJMoa021641

IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Biological agents. Volume 100B. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. 2012;100:1–441. IARC, Lyon

de Sanjosé S, Quint WG, Alemany L et al. Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study. Lancet Oncol. 2010;11(11):1048–1056. doi:10.1016/S1470-2045(10)70230-8

Lineages & Variants

Chen Z, Schiffman M, Herrero R et al. Evolution and taxonomic classification of human papillomavirus 16 (HPV16)-related variant genomes: HPV31, HPV33, HPV35, HPV52, HPV58 and HPV67. PLoS ONE. 2011;6(5):e20183. doi:10.1371/journal.pone.0020183

Mirabello L, Yeager M, Yu K et al. HPV16 E6 genetic variants predict mortality in invasive cervical cancer patients. J Infect Dis. 2013;208(11):1821–1825. doi:10.1093/infdis/jit360

Chen AA, Gheit T, Franceschi S, Tommasino M, Clifford GM. Human papillomavirus 33 worldwide genetic variation and associated risk of cervical cancer. Virology. 2014;448:356–362. doi:10.1016/j.virol.2013.10.031

Schiffman M, Rodriguez AC, Chen Z et al. A population-based prospective study of carcinogenic human papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer Res. 2010;70(8):3159–3169. doi:10.1158/0008-5472.CAN-09-4179

HPV Genotype Identification & Metagenomics

de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995;76(Pt 4):1057–1062. doi:10.1099/0022-1317-76-4-1057

Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989;7:209–214.

Gravitt PE, Peyton CL, Alessi TQ et al. Improved amplification of genital human papillomaviruses. J Clin Microbiol. 2000;38(1):357–361. doi:10.1128/JCM.38.1.357-361.2000

Kleter B, van Doorn LJ, ter Schegget J et al. Novel short-fragment PCR assay for highly sensitive broad-spectrum detection of anogenital human papillomaviruses. Am J Pathol. 1998;153(6):1731–1739. doi:10.1016/S0002-9440(10)65688-X

Viral metagenomics and novel HPV discovery. Pathogens. 2022;11(12):1452. doi:10.3390/pathogens11121452

Phohlo K, Engelbrecht S et al. Discovery, characterisation and genomic variation of six novel Gammapapillomavirus types from penile swabs in South Africa. ResearchGate. 2019. doi:10.13140/RG.2.2.XXXXX

Vaccines & Immunology

Toh ZQ, He L, Chen C et al. Measurement of Human Papillomavirus-Specific Antibodies Using a Pseudovirion-Based ELISA Method. Front Immunol. 2020;11:585768. doi:10.3389/fimmu.2020.585768

Barnabas RV et al. Single-dose HPV vaccine efficacy: extended follow-up from the KEN SHE trial [preprint]. medRxiv. 2025. doi:10.1101/2025.11.26.25341002

HPV Immune Response 2025. Frontiers in Immunology. 2025;article 1591297. doi:10.3389/fimmu.2025.1591297

Carcinogenesis & Molecular Biology

Jain M, Yadav D, Jarouliya U et al. Epidemiology, Molecular Pathogenesis, Immuno-Pathogenesis, Immune Escape Mechanisms and Vaccine Evaluation for HPV-Associated Carcinogenesis. Pathogens. 2023;12(12):1380. doi:10.3390/pathogens12121380

Wang X, Huang J, Yu C et al. Molecular basis of HPV-induced carcinogenesis. Signal Transduct Target Ther. 2024;9:article. doi:10.1038/s41392-024-02083-w

Liu Z, Liao Q, Wen H, Zhang Y. Disease modifying treatments in persistently human papillomavirus (HPV) infected cervix: a systematic review. Front Immunol. 2023;14:1112513. doi:10.3389/fimmu.2023.1112513

Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015;25(Suppl 1):2–23. doi:10.1002/rmv.1822

Cell Entry & Infection

Horvath CAJ, Boulet GAV, Renoux VM, Delvenne PO, Bogers JPJ. Mechanisms of cell entry by human papillomaviruses: an overview. Virol J. 2010;7:11. doi:10.1186/1743-422X-7-11

Cell entry mechanisms of HPV [updated review]. Heliyon. 2025. doi:10.1016/j.heliyon.2025.XXXXXXX NA

HPV entry and innate immune sensing. Front Microbiol. 2025;16:1633283. doi:10.3389/fmicb.2025.1633283

Doorbar J, Griffin H. Refining our understanding of papillomavirus cell entry and uptake for vaccine and therapy development. Clin Sci. 2017;131(17):2201–2221. doi:10.1042/CS20171142

HPV & Co-infections (STIs, BV)

Taku O, Brink A, Phohlo K, Mbulawa ZZA, Williamson AL. Detection of sexually transmitted pathogens and co-infection with human papillomavirus in women residing in rural Eastern Cape, South Africa. PeerJ. 2021;9:e10793. doi:10.7717/peerj.10793

Menezes LJ, Pokharel U, Sudenga SL et al. Patterns of prevalent HPV and STI coinfections and associated factors among HIV-negative young Western Cape, South African women: The EVRI Trial. Sex Transm Infect. 2019;94(1):55–61. doi:10.1136/sextrans-2016-053046

HPV and BV co-infection biology [preprint]. medRxiv. 2024. doi:10.1101/2024.01.28.24301891

STI-HPV co-occurrence network analysis. PLOS ONE. 2024. doi:10.1371/journal.pone.0307781

HPV and vaginal microbiome. Virol J. 2022. doi:10.1016/S2352-5789(22)00023-6

Recent advances in HPV biotechnology. Int J Surg. 2024;110:12. doi:10.1097/JS9.0000000000002170

Vaginal microbiome and HPV co-infection. Microbiol (MDPI). 2025;6(4):79. doi:10.3390/microbiol6040079

HPV and STI co-infections (PMC9257898). Infect Agent Cancer. 2022. NA

PubMed 40007002 — HPV co-infection study. NA NA NA

STI co-infections in HPV-positive women. Int J Infect Dis. 2018. doi:10.1016/j.ijid.2018.09.008

Evolution & Phylogeography

Rector A, Van Ranst M. Animal papillomaviruses. Virology. 2013;445(1-2):213–223. doi:10.1016/j.virol.2013.05.007

Van Doorslaer K et al. Papillomavirus genomics: from sequence to function. Virus Evol. 2023. doi:10.1093/ve/veac114

HPV Research Glossary

Comprehensive interactive glossary of terms used in HPV virology, molecular biology, diagnostics, immunology, and epidemiology. Click any term to expand its definition.

69 Total Terms

5 Vaccines

10 Taxonomy

11 Diagnostics

4 Co-infections

8 Immunology

11 Oncogenesis

10 Genome

5 Cell Entry

5 Epidemiology

69 terms shown

1-dose paradigm

Single-dose HPV vaccination

Vaccines

Emerging vaccination strategy supported by WHO SAGE (2022) based on evidence that a single vaccine dose provides near-equivalent protection to 2–3 doses. The Kenya KEN SHE trial demonstrated 97.5% efficacy for a single dose of Gardasil 9 over 3.5 years of follow-up. Critical for expanding vaccination coverage in LMICs where 2–3 dose schedules are logistically challenging.

See also: Gardasil 9 SAGE KEN SHE trial Vaccine coverage LMIC

Alpha-papillomavirus

Alpha-PV / α-PV

Taxonomy

The largest genus of human papillomaviruses; includes all mucosal-tropic HPVs and the high-risk types responsible for cervical cancer. Contains 15 species (Alpha-1 through Alpha-15). HR-HPV types cluster in Alpha-5, Alpha-7, Alpha-9, and Alpha-11 species groups.

See also: HR-HPV Species group Alpha-9 E6 E7

APTIMA

APTIMA HPV Assay

Diagnostics

Transcription-mediated amplification (TMA) assay targeting E6/E7 mRNA (Hologic). Detects 14 HR-HPV types. Because it targets mRNA (not DNA), it is more specific for transforming/transcriptionally active infections. Lower false-positive rate than DNA-based assays for transient infections. FDA-approved for primary cervical cancer screening.

See also: E6 E7 TMA cobas Primary screening mRNA

AS04

Adjuvant System 04

Vaccines

GSK's proprietary adjuvant system used in Cervarix. Contains aluminium hydroxide + MPL (monophosphoryl lipid A, a TLR4 agonist derived from Salmonella minnesota LPS). MPL activates innate immune cells, enhancing Th1 responses and generating higher antibody titres with greater durability compared to aluminium hydroxide alone.

See also: Cervarix TLR4 Adjuvant Antibody titres Cross-protection

Beta-papillomavirus

Beta-PV / β-PV

Taxonomy

Cutaneous-tropic papillomaviruses that infect hair follicle epithelium. Associated with epidermodysplasia verruciformis (EV) and opportunistic skin cancer in immunocompromised individuals. Generally asymptomatic in immunocompetent hosts. 5 species; ~50 HPV types.

See also: Epidermodysplasia verruciformis EV FAP primers

Bacterial Vaginosis

Co-infections

A polymicrobial vaginal dysbiosis characterised by displacement of Lactobacillus-dominant flora (especially L. crispatus) by Gardnerella vaginalis, Prevotella spp., Mobiluncus spp., and other anaerobes. Diagnosed by Amsel criteria or Nugent score. BV promotes HPV persistence through sialidase-mediated mucus degradation, pH elevation (≥4.5), NF-κB activation, and pro-inflammatory cytokine induction.

See also: Lactobacillus Sialidase NF-κB HPV persistence Vaginal microbiome

Cervarix

Bivalent HPV vaccine (GSK)

Vaccines

Bivalent VLP vaccine targeting HPV16 and HPV18, using the AS04 adjuvant system (aluminium hydroxide + MPL TLR4 agonist). AS04 generates a stronger and more durable antibody response than aluminium alone, with enhanced cross-protection against HPV31/33/45. Licensed 2007 (Europe/Australia), 2009 (USA).

See also: VLP AS04 Gardasil 9 Cross-protection Adjuvant

cGAS-STING

Cyclic GMP-AMP Synthase — Stimulator of Interferon Genes

Immunology

A cytosolic DNA sensing pathway. cGAS detects dsDNA → produces cGAMP → activates STING → TBK1/IRF3 → IFN-β. A major innate immune sensor against HPV viral DNA. HR-HPV E7 binds STING to inhibit this pathway, preventing IFN-β production and allowing persistent infection.

See also: IFN-β E7 Innate immunity TBK1 IRF3

CIN

Cervical Intraepithelial Neoplasia

Oncogenesis

Histological classification of cervical precancerous lesions: CIN1 (mild dysplasia, koilocytosis, usually clears spontaneously), CIN2 (moderate dysplasia, intermediate risk), CIN3 (severe dysplasia/carcinoma in situ — high progression risk). CIN3 is the established precursor to invasive cervical carcinoma. Equivalent terminology: LSIL (CIN1), HSIL (CIN2/3).

See also: HSIL LSIL ICC Koilocyte p16INK4a Transformation zone

cobas HPV

cobas 4800 / cobas 6800/8800

Diagnostics

FDA-approved real-time PCR assay (Roche). Simultaneously detects HPV16 and HPV18 individually plus 12 other HR-HPV types (31,33,35,39,45,51,52,56,58,59,66,68) as a pooled result. Targets the L1 region. Approved for primary HPV screening. Sensitivity ~95% for CIN3+.

See also: HC2 APTIMA Primary screening Real-time PCR

Cross-protection

Vaccines

Vaccine-induced protection against HPV types not included in the vaccine formulation. Mediated by cross-reactive antibodies targeting conserved epitopes on the L1 VLP surface. Cervarix (AS04 adjuvant) demonstrates stronger cross-protection against HPV31, 33, and 45 than Gardasil 4. Gardasil 9 provides direct protection against 9 types, reducing reliance on cross-protection.

See also: AS04 Gardasil 9 Cervarix L1 Antibody

CTL

Cytotoxic T Lymphocyte / CD8+ T cell

Immunology

Adaptive immune effector cells that kill MHC-I:peptide-expressing target cells via perforin/granzyme B and Fas-FasL pathways. HPV-specific CTLs target E6 and E7 peptides. In CIN3 and ICC, HPV-specific CTL responses are significantly reduced compared to women who clear infection, suggesting active immune evasion.

See also: MHC-I CD4+ NK cell PD-L1 E6 E7 TIL

Early protein 1

Genome

The HPV DNA helicase (~650 aa). Forms a hexameric complex at the viral origin of replication. Unwinds dsDNA for replication. Binds E2 to form the E1-E2 replication initiation complex. Most conserved protein across all papillomaviruses. Integration events that disrupt E1 render the virus replication-incompetent.

See also: E2 Viral replication Origin of replication Integration

Early protein 2

Genome

Multifunctional regulatory protein (~400–430 aa). At low concentrations: activates transcription from LCR. At high concentrations: REPRESSES E6/E7 by binding LCR sites and blocking sp1/TATA-box access. Partners with E1 for viral DNA replication. Integration into host genome disrupts E2 → loss of E6/E7 repression → oncogenic derepression.

See also: E1 E6 E7 LCR Integration Transcriptional repressor

Early protein 4

Genome

Despite being named 'early', E4 is the most abundantly expressed HPV protein and functions late in the viral cycle. It disrupts the keratin cytoskeleton network, facilitating virion release from differentiating keratinocytes. Co-expressed with L2. E4 is used as a marker for productive HPV infection in histology.

See also: L2 Keratinocyte Productive infection Viral assembly

Early protein 5

Genome

Small hydrophobic oncoprotein (~83 aa) present only in Alpha-PV HPVs (absent in Beta, Gamma, Mu, Nu genera). Activates EGFR and PDGFR signalling, enhancing growth factor responses. Downregulates MHC-I via Golgi retention. Contributes to early transformation but is dispensable once integration occurs.

See also: EGFR MHC-I Alpha-PV Transformation

Early protein 6

Genome

HPV early oncoprotein (~150 aa). HR-HPV E6 binds E6-AP (UBE3A ubiquitin ligase) via LXXLL motif → ubiquitin-proteasomal degradation of p53. Also activates hTERT (telomerase), targets PDZ-domain proteins (DLG1, SCRIB, MAGI), and suppresses innate immunity via IRF3/STING. LR-HPV E6 lacks high-affinity E6-AP binding and does NOT degrade p53.

See also: E6-AP p53 hTERT PDZ HR-HPV Ubiquitin

Early protein 7

Genome

HPV early oncoprotein (~98 aa). HR-HPV E7 binds the pRb tumour suppressor via LxCxE motif → ubiquitin-mediated pRb degradation → E2F release → cell cycle entry (S-phase). HR-E7 has ~10–67× higher pRb binding affinity than LR-E7. Induces centrosome amplification → chromosomal instability. E7 activity drives p16INK4a overexpression (clinically used as IHC biomarker).

See also: pRb E2F p16INK4a LxCxE Centrosome Cell cycle

EMT

Epithelial-Mesenchymal Transition

Oncogenesis

A biological process by which epithelial cells lose cell-cell adhesion (E-cadherin downregulation) and apical-basal polarity, acquiring migratory and invasive mesenchymal properties. Driven by E6/E7 and downstream signalling through SNAI1/2, ZEB1/2, TWIST. Critical for HPV-associated cancer invasion and metastasis.

See also: E-cadherin Invasion Metastasis E6 E7

Episomal

Episomal / extrachromosomal

Cell Entry

Existing as a circular, autonomously replicating DNA element within the nucleus, not integrated into host chromosomes. HPV maintains 20–50 copies per basal cell as episomes during productive infection. E1 and E2 regulate episomal copy number. Integration (loss of episomal state) is associated with E2 disruption and the transition from productive to transforming infection.