Part 1: Microsatellite finding and primer design by eye

1 a)

The repeat unit sequence for this microsatellite is “ATAG”. There are 11 tandem repeat units. The microsatellite is 44 base pairs in length and the first nucleotide (A) is at position 141 and the last (G) is at 184. This is a pure tetranucleotide microsatellite.

DNA Sequence with Microsatellite underlined:

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("1aMicrosatellite.png"))

1b) (Rules obtained from Lecture 2 (Bentzen, 2024))

1.usually 18-25 bases long 2.reasonably balanced base composition 3.Tm (~) = (4 x (G x C))+(2 x (A + T)) [for 20mer or less] 4.avoid runs of nucleotides and palindromic base sequences 5.exact match at 3’ end of primer 6.primers must not have complementary 3’ ends

1c)

Labeled Primer Binding Sites

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("PrimerSites.png"))

Forward Primer: CTTTGTTCCTCTTAGTGGTCCC

  • Forward Primer Tm: Tm (~) = (4 x (G + C)) + (2 x (A + T))

  • = (4 x (4 + 7)) + (2 x (1 + 10))

  • = 66

  • Forward Primer length: 22

  • Forward Primer %GC content: 11/22 = 50%

Reverse Primer: AGTGTATAAGCTACTGGATGACC

  • Reverse Primer Tm: Tm (~) = (4 x (G + C)) + (2 x (A + T))

  • = (4 x (6 + 4)) + (2 x (7 + 6))

  • = 66

  • Reverse Primer length: 23

  • Reverse Primer %GC content: 10/23 = 43.48%

Part 2: Microsatellite finding and primer design using computer programs

2a)

The repeat unit sequence is “CA”, there are 16 tandem repeat units making the microsatellite 32 base pairs long. The first nucleotide (C) is at position 143 and the last (A) is at 174. This is a pure dinucleotide microsatellite.

GenBank printout of sequence (AJ279083.1, 2008):

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("DogGenBank.png"))

Accession number: AJ279083

Canis familiaris microsatellite DNA, clone 391N14 (locus CUX20001) FASTA format with microsatellite bolded (AJ279083.1, 2008):

CCTAGAGTTTGGCTTGTTTGGGGGTCTGAGCATGGCTTTGAAATCCTCCGTTGCGTTTTTAAAATCTAAC TTTCTGTCTCCAATGGAGAGAAGCAGAGGGAGGAAAGCAAAAGCAGAGAGGCTGGGAGACCCCCTCCCTT CC CACACACACACACACACACACACACACACACA GCGCCGGAGTCCCCCAAGCCCGAGGCATCAAAAGCCGGGAAACTTACCTGG

2b)

Microsatellite repeats finder printout (Microsatellite repeats finder, n.d.):

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("DogMicrosatFinder.png"))

2c)

Primer3 printout (Rozen & Skaletsky, 2000):

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("DogPrimer3.png"))

### Primer3 statistics (Rozen & Skaletsky, 2000):

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("Primer3stats.png"))

Primer Selection

I would not choose the main primer pair because the reverse is a repeating dinucleotide sequence that may cause looping. I wouldn’t choose the third additional pair because there is complementarity at the 3’ end which can lead to primer dimer. I wouldn’t choose the first or fourth additional pairs because the difference in annealing temperatures of the forward and reverse primers are at least one degree celsius. I would pick the second additional pair because the %GC is 50%, the annealing temperatures are only 0.07 degrees different, there’s no repeats longer than four bases, and the 3’ ends aren’t complementary.

Forward Primer (Rozen & Skaletsky, 2000): GCTTTGAAATCCTCCGTTGC

  • Forward Primer Tm: Tm (~) = (4 x (G + C)) + (2 x (A + T))

  • = (4 x (4 + 6)) + (2 x (3 + 7))

  • = 60

  • Forward Primer length: 20

  • Forward Primer %GC content: 10/20 = 50%

Reverse Primer (Rozen & Skaletsky, 2000):CAGGTAAGTTTCCCGGCTTT

  • Reverse Primer Tm: Tm (~) = (4 x (G + C)) + (2 x (A + T))

  • = (4 x (5 + 5)) + (2 x (3 + 7))

  • = 60

  • Reverse Primer length: 20

  • Reverse Primer %GC content: 10/20 = 50%

Origin Sequence (AJ279083.1, 2008) with Primer Binding Regions Labeled:

#change the path in quotes to the path to your screenshot
knitr::include_graphics(rep("PrimerPairs.png"))

2d)

The sequence for the forward primer is identical to the given sequence because it will be complementary to the other strand not shown that it will bind to in order to proceed with DNA synthesis in the 5’ -> 3’ direction.

The reverse primer is given in the 5’ -> 3’ direction, it is the complementary strand not shown to the given sequence and as such it’s given as backwards to the original sequence with the corresponding opposite base pair nucleotides. This is because it will bind to the given sequence and begin DNA synthesis in the reverse direction from right to left (5’ -> 3’).

Taq polymerase will extend the complementary strands from the primers, adding bases to the 3’ ends, leading to amplification of both DNA strands.

References

AJ279083.1 (2008, October 23). Canis familiaris microsatellite DNA, clone 391N14 (locus CUX20001) (Nucleotide) [Database]. National Library of Medicine, National Center for Biotechnology Information. https://www.ncbi.nlm.nih.gov/nuccore/AJ279083.1

Bentzen, P. (2024, January 11). Molecular Toolbox (1): Allozymes, Sanger sequencing & PCR [PowerPoint Slides].

Microsatellite repeats finder. Find tandem repeats. (n.d.). http://insilico.ehu.es/mini_tools/microsatellites/?info

Rozen, S., Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.